Տեղեկատվություն

Այբբենարան դիզայն Gibson հավաքների համար

Այբբենարան դիզայն Gibson հավաքների համար


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ես փորձում եմ նախագծել այբբենարան Gibson հավաքման համար: Իմ հետաքրքրության գենը պլազմիդի վրա է, և ես ուզում եմ պատճենել այդ գենը և դնել այլ պլազմիդի մեջ:

Ես վստահ չեմ, թե ինչպես կարող եմ նախագծել իմ այբբենարանները PCR- ի համար: Ես գիտեմ, որ ինձ անհրաժեշտ է այբբենարանների 2 հավաքածու (4 ընդհանուր):

  1. Հետ և առաջ այբբենարան՝ այն պահող պլազմիդից իմ գենը պատճենելու համար:
  2. Պլազմիդը պատճենելու համար հետ և առաջ այբբենարան:

Ես նաև գիտեմ, որ ես պետք է ստեղծեմ իմ գենի և այն պլազմիդի միջև համընկման լրացուցիչ տարածքներ, որոնցում ցանկանում եմ տեղադրել այն: Ինչպե՞ս դա անել:

Ահա պլազմիդն ու գենը: Ես ուզում եմ գենը տեղադրել բիոբրիկ նախածանցի և վերջածանցի միջև:

Ահա, թե ինչ այբբենարաններ, կարծում եմ, ինձ պետք են.

Այն պլազմիդի համար, որի մեջ ես ուզում եմ տեղադրել գենը, իմ պրայմերները պետք է լինեն

  • Փոխանցել:ATTCGCGGCCGCTTCTAGAG
  • Հակադարձ:CTGACGCGGCCGCTACTAGTA

Պրայմերներ՝ գենը պատճենելու և համընկնումը ավելացնելու համար

  • Հակադարձ:ATCATTTCAAATTCGTCCATCTCTAGAAGCGGCCGCGAAT
  • Փոխանցել:AATTAGAAAGAGATTATAATACTAGTAGCGGCCGCTGCA

Ահա գենը

Ահա այն պլազմիդը, որի մեջ ուզում եմ տեղադրել: Ես օգտագործում եմ հոյակապ, բայց կարծում եմ, որ այս նպատակով բառը լավ է աշխատում:


Ուրացում. Ես երբեք չեմ արել Գիբսոնի հավաքը, բայց ահա իմ տեսական ըմբռնումը, թե ինչպես ձևավորել ձեր այբբենարանները: Ձեզ անհրաժեշտ է չորս 40մեր, որոնցից յուրաքանչյուրը բաղկացած է 20 bp հատվածներից, որոնք ստացվում են վեկտորից և ներդիրից և համապատասխանում են այն հանգույցներին, որոնք դուք փորձում եք ստեղծել: Ստորև բերված գծապատկերում կետավոր գծերը ներկայացնում են յուրաքանչյուր 40 մ -ի երկու 20 bp հատվածների միջև միացումները:


Ահա Gibson հավաքածուն օգտագործելիս այբբենարանների նախագծման նկատառումների լավ ակնարկ: http://j5.jbei.org/j5manual/pages/22.html


Այբբենարանի ձևավորում Gibson հավաքման համար - Կենսաբանություն

Գործիքը նախագծում է 60 նուկլեոտիդ (nt) երկարություն ունեցող այբբենարաններ: Յուրաքանչյուր այբբենարան ներառում է 20 նտ գենին հատուկ հաջորդականություն կաղապարի կռելու համար և 30-40 նտ համընկնման հաջորդականություն, որը կօգտագործվի երկու հարակից բեկորների միջև միատեսակ համընկնում առաջացնելու համար:

40 bp հոմոլոգ հաջորդականություն

Gibson Assembly® Primer Design Tool- ը կստեղծի այբբենարաններ, որոնք օգտագործվում են բեկորներին համասեռ համընկնումներ ավելացնելու համար `թույլ տալով արդյունավետ հավաքվել: Այբբենարանները ամրագրված են 60 նուկլեոտիդների երկարությամբ և ներառում են գենային հատուկ հաջորդականության 20 նուկլեոտիդ՝ կաղապարի եռացման համար: Վեկտորի և ներդիրի խաչմերուկի միջև կարող եք ներառել հաջորդական մոտիվ ՝ մինչև 10 նտ երկարությամբ, որը թույլ կտա սահմանափակել մարսողությունը: Արդյունքում, PCR- ի ուժեղացումից հետո կարող է առաջանալ 30-40 bp համասեռ համընկնում: Համընկնման չափը բավարար է մեկ բեկորային հավաքածուին մինչև 10 կբ, կամ մինչև 15 բեկոր `յուրաքանչյուրը մինչև 1 կբ ներդիրներով: Խոշոր գեների հավաքման համար խորհուրդ է տրվում ընդլայնել հոմոլոգ համընկնումը:


Գիբսոնի հավաքի ակնարկ

Գիբսոնի հավաքման տեխնիկան առաջին անգամ նկարագրվել է դոկտոր Դանիել Գիբսոնի և Ջ. Քրեյգ Վենտերի ինստիտուտի գործընկերների կողմից 2009 թվականին: Այստեղ Addgene-ում մենք այս տարբերակը ավելացրինք ավանդի գործընթացում կլոնավորման ընդհանուր տարբերակների բացվող ընտրացանկում 2014 թվականին դրա շահույթի պատճառով: ժողովրդականության մեջ: Գիբսոնի հավաքումը լավ հայտնի է նրանով, որ թույլ է տալիս հեշտությամբ հավաքել բազմաթիվ գծային ԴՆԹ բեկորներ, բայց կարող է օգտագործվել նաև ներդիրի հիմնական կլոնավորման մեջ ձեր ընտրած վեկտորի մեջ, ինչպես ցույց է տրված ստորև նկարում: Սկսելու համար, դուք պետք է ունենաք ԴՆԹ-ի բեկորներ, որոնց ծայրերում հոմոլոգիայի շրջաններ կան, որոնք սովորաբար ստեղծվում են PCR-ով: Այնուհետև բեկորները ինկուբացվում են ֆերմենտային հիմնական խառնուրդով, որը պարունակում է երեք տարբեր ֆերմենտներ.

  • էկզոնուկլազա, որը հետ է ծամում բեկորի 5 ’ծայրերը ՝ առաջացնելով երկար վերելքներ, ինչը թույլ է տալիս հոմոլոգիայի միակողմանի շրջափակված հատվածները փչանալ
  • պոլիմերազ՝ բացերը լրացնելու համար
  • մի ԴՆԹ լիգազ ՝ փակված և լցված բացերի պատերը փակելու համար

Ֆերմենտների այս խառնուրդի մեծ մասն այն է, որ նրանք բոլորը կարող են աշխատել նույն ջերմաստիճանում, ուստի ամբողջ ռեակցիան տևում է մեկ ժամ կամ ավելի քիչ ՝ 50 ° C- ում: Մոտ մեկ ժամ հետո նմուշն անմիջապես պատրաստ է վերածվել իրավասու բջիջների: Ֆերմենտների հիմնական խառնուրդը կարելի է ձեռք բերել ընկերությունից (օրինակ՝ NEB կամ SGI-DNA), կամ կարող եք ինքներդ խառնել (օրինակ՝ տես Միլլերի լաբորատորիայի արձանագրությունը): Գիբսոնի հավաքման գործընթացը կարող է օգտագործվել մեկ քայլով մինչև 6 բեկոր հավաքելու համար, ինչը հանգեցնում է առանց սպիների հավաքման, որը չի պահանջում հատուկ սահմանափակման վայրերի առկայություն (կամ դրանց բացակայություն) կամ լուրջ ժամանակային պարտավորություն: Մեկ այլ առավելություն այն է, որ այս գործընթացը հեշտացնում է վայրի տիպի և մուտանտի կառուցվածքների առաջացումը միաժամանակ, այլ ոչ թե հաջորդաբար:


Gibson Assembly-ը բեկորները պլազմիդի մեջ մտցնելու հանրաճանաչ միջոց է՝ առանց սահմանափակող ֆերմենտների օգտագործման: Այս մեթոդը մոդելավորելու համար SnapGene-ն ապահովում է ինտուիտիվ ինտերֆեյս:

Gibson ժողովի համար PCR-ն ուժեղացնում է ԴՆԹ-ի հատվածները՝ համընկնող ծայրեր ստեղծելու համար: Այնուհետև ինկուբացրեք ուժեղացված արտադրանքները հավաքման ֆերմենտներով և խառնուրդը վերածեք բակտերիաների:

SnapGene- ը պարզեցնում է Գիբսոնի հավաքումը `ավտոմատացնելով այբբենարանի դիզայնը: Gibson Assembly- ի արձագանքը պլանավորելու համար պարզապես ընտրեք ԴՆԹ -ի բեկորները, որոնց ցանկանում եք միանալ, և SnapGene- ը կընտրի համապատասխան նախաներկեր:

Այս կայքերը լրացուցիչ տեղեկություններ են տրամադրում Գիբսոնի հավաքի մասին.

«SnapGene-ը մեզ շատ օգնեց մեր Gibson հավաքների և սահմանափակման կլոնավորման քայլերի պլանավորման, ինչպես նաև մեր մրցանակակիր պրոմոուտերների հավաքածուի ձևավորման հարցում: Կարծում եմ, որ չի եղել մի օր, երբ մենք չօգտագործենք ծրագրակազմը »:


Կլոնավորել՝ օգտագործելով Gibson Assembly Wizard-ը

Assembly Wizard- ին մուտք գործելու համար նախ բացեք հաջորդական ֆայլ: Ձեր էկրանի ներքևում դուք կգտնեք «Վեհաժողովի հրաշագործ» ՝ «Սպլիտ» աշխատանքային տարածքի կողքին: Սեղմեք Assembly Wizard, ապա ընտրեք Ստեղծել նոր ժողով: Տրված տարբերակներում ընտրեք Gibson և սեղմեք Start՝ հավաքումը շարունակելու համար:

Բացեք ողնաշարի հաջորդականությունը և սեղմեք Backbone բնիկը: Ողնաշարային հաջորդականությունը սահմանափակող ֆերմենտային կտրվածքով գծայնացնելու համար սեղմեք կտրված հատվածի վրա, պահեք Shift- ը և նորից կտտացրեք այն: Սեղմեք Set Fragment ՝ ողնաշարը սահմանելու համար:

Բացեք հաջորդ տեղադրման հաջորդականությունը և կտտացրեք Տեղադրեք անցքը: Ընտրեք ներդիրի բոլոր հիմքերը: Սեղմեք Set Fragment- ը `առաջին ներդիրը տեղադրելու համար:

Սեղմեք հավաքման հրաշագործի աջ կոճակը + ՝ մեկ այլ ներդիր ավելացնելու համար: Բացեք հաջորդ ներդիրը և կտտացրեք նոր Տեղադրեք անցքը: Կրկին ընտրեք ներդիրի բոլոր հիմքերը: Երկրորդ ներդիրը տեղադրելու համար սեղմեք Set Fragment- ը:

Եթե ​​ցանկանում եք ավելացնել երկու տողերի միջև «kozak» տիպի տողերի հաջորդականությամբ, կտտացրեք «Ավելացնել տարածություն հետո» կոճակին: Անվանեք spacer-ը «kozak» և դրա հիմքերը դրեք gccacc: Սեղմեք Պահպանել՝ միջակայքի հաջորդականությունը սահմանելու համար:

Հենց որ ձեր հավաքումն ավարտվի, վերանվանեք ժողովը ձեր ուզած կոնստրուկտիվ անունով և սեղմեք «Հավաքվել» հավաքման հրաշագործի աջ կողմում:

Ընտրեք թղթապանակի ցանկալի վայրը ինչպես հաջորդականությունների պանակի, այնպես էլ այբբենարանի թղթապանակի համար: Կտտացրեք Ստեղծել ՝ հավաքումն ավարտելու համար:

Բացեք նոր հավաքված կոնստրուկցիան և կտտացրեք պատմության վահանակին ՝ հաջորդականության տոհմը դիտելու համար: Ուշադրություն դարձրեք, որ հավաքված հաջորդականության վրա գտնվող ողնաշարը և ներդիրի հատվածները գունավոր են:

Բացեք ժողովի ներդիրը՝ ժողովի ակնարկը տեսնելու, այն տպելու կամ այբբենարանները արտահանելու համար:

Եթե ​​դուք փոխարինեք ձեր հաջորդականություններից որևէ մեկը ձեր այբբենարանի կապակցման տեղում, Benchling-ը ավտոմատ կերպով կթարմացնի այբբենարանը և կցուցադրի մուտացիան Ասամբլեայի ներդիրում Անհամապատասխանությունները Ներածված աղյուսակում:

Հավաքված հաջորդականությանը հավասարեցնելու կամ դրա վրա կամայական փոփոխություններ կատարելու համար բացեք «Համագումար» ներդիրը և սեղմեք «Ավարտել» վերևի աջ կողմում:

Նշում. Մոնտաժման հրաշագործը չի ակնկալում, որ հոմոլոգիական ձեռքերը կներառվեն ողնաշարի/ներդիրի մեջ, քանի որ դրանք պարզապես միավորված են միասին:


Հղումներ

Hughes RA, Ellington AD. Սինթետիկ ԴՆԹ-ի սինթեզ և հավաքում. սինթետիկը սինթետիկ կենսաբանության մեջ դնելը: Cold Spring Harb Perspect Biol. 20179 (1) ՝ 1–17:

Էլիս Թ, Ադի Թ, Բոլդուին Գ. ԴՆԹ -ի հավաքում սինթետիկ կենսաբանության համար. Մասերից դեպի ուղիներ և դրանից դուրս: Integr Biol (Camb): 20113 (2): 109–18.

Cobb RE, Ning JC, Zhao H. ԴՆԹ-ի հավաքման տեխնիկա բնական սերունդների հաջորդ սերնդի կոմբինատորային կենսասինթեզի համար: J Ind Microbiol Biotechnol. 201441 (2) ՝ 469–77:

Chao R, Yuan Y, Zhao H. ԴՆԹ -ի հավաքման տեխնոլոգիաների վերջին ձեռքբերումները: FEMS խմորիչ Res. 201515 (1):1–9.

Juhas M, Ajioka JW. Բարձր մոլեկուլային քաշով ԴՆԹ-ի հավաքում in vivo սինթետիկ կենսաբանության կիրառման համար: Crit Rev Biotechnol. 201737 (3): 277–86.

Liang J, Liu Z, Low XZ, Ang EL, Zhao H. Twin-primer-ի ոչ ֆերմենտային ԴՆԹ-ի հավաքում. արդյունավետ և ճշգրիտ բազմամաս ԴՆԹ-ի հավաքման մեթոդ: Nucleic Acids Res. 201745: e94.

Jin P, Ding W, Du G, Chen J, Kang Z. DATEL. ԴՆԹ-ի առանց սպիների և հաջորդականությունից անկախ հավաքման մեթոդ՝ օգտագործելով ջերմակայուն էկզոնուկլեազներ և լիգազան: ACS Synth Biol. 20165 (9): 1028–32:

Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA 3rd, Smith HO. ԴՆԹ մոլեկուլների ֆերմենտային հավաքում մինչև մի քանի հարյուր կիլոբազ: Nat մեթոդներ. 20096 (5): 343–5:

Engler C, Gruetzner R, Kandzia R, Marillonnet S. Ոսկե դարպասի խառնուրդ. Մեկ կաթսայի ԴՆԹ-ի խառնուրդի մեթոդ ՝ հիմնված II տիպի սահմանափակող ֆերմենտների վրա: PLoS One. 20094 (5):e5553.

Bitinaite J, Rubino M, Varma KH, Schildkraut I, Vaisvila R, Vaiskunaite R. ՕԳՏԱԳՈՐԾՈՂԻ ԴՆԹ-ի ինժեներական և կլոնավորման մեթոդ՝ ուրացիլային հեռացման միջոցով: Nucleic Acids Res. 200735 (6) ՝ 1992–2002 թթ.

de Kok S, Stanton LH, Slaby T, Durot M, Holmes VF, Patel KG, Platt D, Shapland EB, Serber Z, Dean J, et al. Արագ և հուսալի ԴՆԹ հավաքում `լիգազի հեծանվային ռեակցիայի միջոցով: ACS Synth Biol. 20143 (2): 97–106.

Shao Z, Zhao H. ԴՆԹ հավաքող. Սինթետիկ կենսաբանության գործիք `բնական արտադրանքի գենային կլաստերների բնութագրման և նախագծման համար: Մեթոդներ Enzymol. 2012517:203–24.

Li MZ, Elledge SJ. Օգտագործելով հոմոլոգ ռեկոմբինացիա in vitro՝ SLIC-ի միջոցով ռեկոմբինանտ ԴՆԹ-ի առաջացման համար: Nat մեթոդներ: 20074 (3): 251–6.

Zhang Y, Werling U, Edelmann W. SLiCE. Բակտերիալ բջիջների քաղվածքների վրա հիմնված ԴՆԹ-ի կլոնավորման նոր մեթոդ: Nucleic Acids Res. 201240(8):e55.

Թիլեթ Դ, Նեյլան Բ.Ա. Ֆերմենտներից ազատ կլոնավորում. PCR- ի արտադրանքի կլոնավորման արագ մեթոդ `անկախ վեկտորային սահմանափակող ֆերմենտների տեղերից: Nucleic Acids Res. 199927 (19) ՝ e26.

Սթիվենսոն Ջ, Քրայսեր Ջ.Ռ., Ֆան Լ, Բրաուն Էյջ. Լիգացիայից անկախ կլոնավորման տեխնիկայի գործնական համեմատություն: PLoS One. 20138 (12) ՝ e83888:

Garcia-Nafria J, Watson JF, Greger IH. IVA կլոնավորում. մեկ խողովակով ունիվերսալ կլոնավորման համակարգ, որն օգտագործում է բակտերիաների in vivo հավաքումը: Գիտական ​​Rep. 20166: 27459:

Liu CJ, Jiang H, Wu L, Zhu LY, Meng E, Zhang DY. OEPR կլոնավորում. արդյունավետ և անխափան կլոնավորման ռազմավարություն խոշոր և բազմաբնույթ հատվածների համար: Գիտության Rep. 20177: 44648:

Zeng F, Hao Z, Li P, Meng Y, Dong J, Lin Y. Գենի վերակառուցման սահմանափակումներից զերծ մեթոդը `օգտագործելով երկու միանվագ PCR- ներ զուգահեռ` համատեղելի համախմբված ծայրեր առաջացնելու համար: BMC Biotechnol. 201717 (1):32.

Չերեզով Վ, Ռոսենբաում Դ.Մ., Հանսոն Մ.Ա., Ռասմուսեն Ս.Գ., Թիան Ֆ.Ս., Կոբիլկա Տ.Ս., Չոյ Հ. ,., Կուն Պ., Վեյս Վ.Ի., Կոբիլկա Բ.Կ., և այլն: Մարդու կողմից մշակված բետա 2-ադրեներգիկ G սպիտակուցային ընկալիչի բարձր լուծման բյուրեղային կառուցվածքը: Գիտություն. 2007318 (5854) ՝ 1258–65:

Ikeda H, Nonomiya T, Usami M, Ohta T, Omura S. Streptomyces avermitilis-ում պոլիկետիդ հակահելմինտիկ մակրոլիդ ավերմեկտինի բիոսինթետիկ գենային կլաստերի կազմակերպում: Proc Natl Acad Sci U S A. 199996 (17). 9509–14:

Garrido LM, Lombo F, Baig I, Nur EAM, Furlan RL, Borda CC, Brana A, Mendez C, Salas JA, Rohr J և այլն: Հակաքաղցկեղային անտրացիկլինի կոսմոմիցինի կենսասինթեզի ընթացքում գլիկոզիլացման փուլերի վերաբերյալ պատկերացումներ. Գլիկոզիլտրանսֆերազի երկու գեների բնութագրում: Appl Microbiol Biotechnol. 200673 (1) ՝ 122–31:

Piel J, Hertweck C, Shipley PR, Hunt DM, Newman MS, Moore BS. Էնտերոցինի կենսասինթեզի գենային կլաստերի կլոնավորում, հաջորդականացում և վերլուծություն «Streptomyces maritimus» ծովային մեկուսացումից. Քիմ Բիոլ. 20007 (12): 943–55:

He J, Hertweck C. Կրկնումը որպես ծրագրավորված իրադարձություն աուրեոտինի բիոսինթեզի գենային կլաստերի պոլիկետիդային հավաքման մոլեկուլային վերլուծության ժամանակ: Քիմ Բիոլ. 200310 (12) ՝ 1225–32:

Յուրկովիչ ME, Tyrakis PA, Hong H, Sun Y, Samborskyy M, Kamiya K, Leadlay PF. Սալինոմիցինի կենսասինթեզի վերջին փուլի միջանկյալ նյութը բացահայտվում է բիոսինթետիկ գեների կլաստերի հատուկ մուտացիայով: Չեմբիոքեմ. 201213 (1) ՝ 66–71:

Դագերտ Մ, Էրլիխ Ս.Դ. Կալցիումի քլորիդի երկար ինկուբացիան բարելավում է Escherichia coli բջիջների իրավասությունը: Գեն. 19796 (1) ՝ 23–8:


GeneArt Gibson Assembly Cloning տեխնոլոգիայի առավելությունները

GeneArt Gibson հավաքման հավաքածուները իդեալական են բազմաթիվ ներդիրներ հավաքելու համար:

Նկար 1. GeneArt Gibson Assembly EX Cloning հավաքածուները ապահովում են փոխակերպման բարձր արդյունավետության տարբերակներ ավելի մեծ թվով ներդիրներ օգտագործելիս: 0.5kb- ի 6, 8 և 10 բեկորների հավաքում pcDNA 3.4 -ում `փոխակերպված Invitrogen TOP10 իրավասու բջիջներում:

GeneArt Gibson Assembly HiFi հավաքածուները առաջարկում են շատ ծախսարդյունավետ և արդյունավետ միջոց՝ փոքր քանակությամբ բեկորներ հավաքելու համար: Ավելի մեծ հավաքածուների համար հասանելի են GeneArt Gibson EX Master Mixes-ը և փաթեթները:

Գծապատկեր 2. GeneArt Gibson Assembly HiFi հավաքածուները ապահովում են կլոնավորման բարձր արդյունավետություն `օգտագործելով մեկ ներդիր` բազմաթիվ ներդիրների նախագծերի համար: 1, 2 և 4 - 1կբ բեկորների հավաքում pCDNA 3.4-ում՝ օգտագործելով TOP10 իրավասու բջիջները: GeneArt Gibson Assembly HiFi հավաքածուներն ամենաարդյունավետ միջոցն են և ժամանակի խնայողությունը մեծ հավաքածուներ կառուցելու համար, մասնավորապես, երբ դրանք օգտագործվում են GeneArt Strings DNA Fragment- երով կամ 100% հաջորդականացված, GeneArt Gene Synthesis- ով:


Ինչպես է աշխատում Գիբսոնի ժողովը

ԴՆԹ-ի ռեկոմբինանտ տեխնոլոգիայի կիրառումը սկսվել է ԴՆԹ-ի լիգազի և սահմանափակող էնդոնուկլեազների հայտնաբերումից անմիջապես հետո: Շուտով պոլիմերազային շղթայական ռեակցիայի (ՊՇՌ) հայտնվելը նոր հնարավորություններ բացեց գենոմային ԴՆԹ-ի բարդ խառնուրդից հատուկ ԴՆԹ-ի հաջորդականությունների ուժեղացման համար: Այս տեխնոլոգիաները մի քանի տասնամյակ շարունակ եղել են ժամանակակից գիտական ​​լաբորատորիայի հենարանը և այսօր մնում են օգտակար մեթոդներ պոտենցիալ արժեքավոր կամ հետաքրքիր ԴՆԹ-ի կլոնավորման համար: Այնուամենայնիվ, քանի որ գիտնականները ձգտում են աշխատել ավելի մեծ ԴՆԹ-ի բեկորների հետ, իրականացնել գենետիկ տարրերի լայնածավալ վերամշակում, սինթեզել ամբողջական գենոմներ և շարժվել դեպի ավտոմատացված մոտեցումներ, ԴՆԹ-ի մանիպուլյացիայի համար անհրաժեշտ տեխնոլոգիաները նույնպես պետք է զարգանան:

Ջ. Քրեյգ Վենտերի ինստիտուտի (JCVI) քննիչները մշակել են մի շարք արհեստական ​​պայմաններում կարճ օլիգոնուկլեոտիդներ հավաքելու ֆերմենտային ռազմավարություններ ՝ ավելի մեծ երկշղթայական ԴՆԹ կոնստրուկցիաների մեջ (1-4): 2003 թվականին JCVI-ն զգալի առաջընթաց է գրանցել սինթետիկ գենոմի արտադրության մեջ՝ հավաքելով 5,386 bp գենոմը phiX174, վիրուս, որը վարակում է բակտերիաները, ընդամենը 14 օրվա ընթացքում (5): Այս մոտեցումը ներառում էր սինթետիկ օլիգոնուկլեոտիդների միացում պոլիմերազային ցիկլային հավաքման միջոցով և հետագայում դրանց ուժեղացում PCR-ով (5-6): Աննախադեպ արագությունը, որով դա ավարտվեց, հիմք դրեց ավելի մեծ և ավելի բարդ գենոմների կառուցման համար:

2004 թվականին JCVI- ն սկսեց սինթեզել Mycoplasma genitalium գենոմը. Պարզվել է, որ համընկնող ԴՆԹ -ի մոլեկուլները կարող են արդյունավետ կերպով միացվել `օգտագործելով երեք ֆերմենտային առանձնահատկություններ. բացված արտադրանքների բացերը և (iii) ԴՆԹ լիգազի գործունեությունը, որը կովալենտային կերպով կնքում է հավաքածուի արդյունքում առաջացած նիկները: Երկքայլ ջերմոցիկլի վրա հիմնված արհեստական ​​պայմաններում Այս ֆերմենտների կիրառմամբ վերամիավորման մեթոդը օգտագործվել է 101 համընկնող ԴՆԹ -ի ձայներիզները չորս մասերի միացնելու համար: M. genitalium գենոմը՝ յուրաքանչյուրը 136 կբ-ից մինչև 166 կբ չափով: Այս նշաձողը նշանավորեց ազատ ապրող օրգանիզմից ստացված գենոմի առաջին հավաքումը: 582,970 bp այս սինթետիկ գենոմը լաբորատորիայում սինթեզված քիմիապես սահմանված ԴՆԹ-ի ամենամեծ կառուցվածքն էր և 18 անգամ ավելի մեծ էր, քան նախկինում սինթեզված ցանկացած ԴՆԹ (4):

Այդ ժամանակից ի վեր ՝ երկու լրացուցիչ արհեստական ​​պայմաններում JCVI- ի կողմից մշակվել են վերակոմբինացիոն մեթոդներ ՝ 300 քբ-ից ավելի ԴՆԹ-ի մոլեկուլները միացնելու և կլոնավորելու համար մեկ քայլով (2-4): Այս մեթոդներից ամենապարզը Gibson Assembly- ն է, մեկ քայլանոց իզոթերմային մոտեցումը, որն օգտագործում է նախկինում նկարագրված նույն երեք ֆերմենտային գործունեությունը: Այս մեթոդը կարող է օգտագործվել ինչպես ssDNA, այնպես էլ dsDNAs միանալու համար:

Նկար 1. Գիբսոնի ժողովի ակնարկ:


Գիբսոնի ժողովը դարձել է ամենաշատ օգտագործվողը արհեստական ​​պայմաններում Վերևում քննարկված հավաքման մեթոդները, քանի որ այն հեշտ է օգտագործել, ճկուն է և կարիք ունի քիչ կամ առանց օպտիմալացման, նույնիսկ մեծ, բարդ հավաքների համար: Այն ամենը, ինչ պահանջվում է, մուտքագրում է ԴՆԹ `համապատասխան համընկնումներով և երեք ֆերմենտների համապատասխան խառնուրդով և հանում Gibson Assembly Master Mix- ը: Գլխավոր խառնուրդին ավելացվում են ԴՆԹ -ի բեկորներ և ինկուբացվում են 50 ° C- ում 1 ժամ, արդյունքում հավաքվող արտադրանքը լիովին կնքված dsDNA է, որը հարմար է մի շարք ստորին հոսանքների համար (Նկար 1): JCVI- ն Gibson Assembly- ի միջոցով արագ սինթեզել է 16,520 bp մկնիկի միտոքոնդրիալ գենոմը 600 համընկնող 60 բազային օլիգոնուկլեոտիդներից (3): Այն նաև օգտագործվել է խմորիչի հավաքման հետ համատեղ՝ 1.1 Մբիթ/վ արագությամբ սինթեզելու համար Mycoplasma mycoides գենոմը, որն այնուհետև ակտիվացվել է ստացող բջիջում՝ արտադրելու առաջին սինթետիկ բջիջը (1):


Համախմբված տարբերակի համար տե՛ս ստորև:

Պատրաստել պլազմիդային քարտեզներ

  • Կազմեք պլազմիդային քարտեզ, թե ինչպիսին պետք է լինի ձեր ավարտված դիզայնը
    • Սա բանալին է: Դուք կցանկանաք դա այբբենարանների ձևավորման, այբբենարանների ստուգման, հաջորդականացման ռեակցիաների գնահատման և այլնի համար: Ես օգտագործում եմ APE, բաց կոդով ծրագրակազմ: Տեսեք իմ APE- ի օգտագործման մեկնաբանությունները Tips & amp Tricks- ում:
    • Հիմնականում դա նշանակում է պատճենել պլազմիդների հաջորդականություններից և տեղադրել նոր պլազմիդային ֆայլ:
      • Այնուամենայնիվ, դուք կարող եք ավելացնել ավելի կարճ տարրեր, ինչպիսիք են խթանողները և ռիբոսոմային կապող կայքերը ՝ դրանք կոդավորելով ձեր սկզբնաղբյուրներում:
      • Կարող եք նաև ավելացնել ԴՆԹ -ի ավելի երկար շրջաններ ՝ օգտագործելով ավելի երկար (90+ bp) օլիգո
      • Դուք կարող եք օգտագործել գենոմային ԴՆԹ, սովորաբար ամբողջ բջիջներից (նախ մաքրման կարիք չկա)
      • Համոզվեք, որ յուրաքանչյուր գեն ունի խթանող ՝ RBS և ցանկության դեպքում դադարեցրեք կոդոնը:
      • Եթե ​​ծանոթ չեք ձեր հաջորդականություններին, համոզվեք, որ սկզբում շրջանակը չունի կանգառի կոդոններ:
      • Ներառեք այբբենարանների կողմից առաջացած համընկնումը:

      Նախագծային այբբենարաններ

      • Այբբենարանի դիզայնը առանցքային է: Եթե ​​ձեր բոլոր PCR-ները լավ արդյունք են տալիս, առանց անցանկալի ժապավենների, փորձարկված ջերմացիկլի բոլոր պայմաններում, ապա ձեր հավաքումը, ամենայն հավանականությամբ, լավ կանցնի:
        • Միշտ լավ նշան է, երբ այբբենարանները աշխատում են մի քանի եռացման ջերմաստիճաններում, որոնք միմյանցից մի քանի oC հեռավորության վրա են, և DMSO կոնցենտրացիաների միջև: Քանի որ հավաքման քայլը այնքան կախված է այբբենարանների հաջորդականությունից և ԴՆԹ -ի միաշղթայի կառուցվածքի բացակայությունից (մազակալներ և այլն), PCR- ի հեշտությունը լավ ցուցանիշ է այն բանի համար, թե արդյոք հավաքումը հավանաբար կընթանա:
        • Եթե ​​ձեր ողնաշարը լավ չի ուժեղանում կամ ուժեղանում է կողմնակի արտադրանքով և պահանջում է գել մաքրում, ապա շատ ավելի քիչ հավանական է, որ հաջողակ հավաքներ ձեռք բերեք: Եթե ​​ստեղծվել է վատ PCR, հաշվի առեք պրայմերի համար կապող շրջանի եռացման ջերմաստիճանը բարձրացնելու > 72 o C և հնարավորության դեպքում օգտագործել վեկտորի տարբեր տարածքներ համընկնման համար:
        • Ի միշտ օգտագործեք այբբենարաններ Tm & gt72 o C- ով հալեցման շրջանի համար: Տմ արժեքները միշտ պետք է հաշվարկվեն Finnzymes կայքի կողմից
          • Այս բանաձևը կիրառելի է Phusion ԴՆԹ պոլիմերազի համար՝ ԴՆԹ պոլիմերազի համար, որն օգտագործվում է ձեր հավաքած ԴՆԹ ստեղծելու համար:

          Կրկնակի ստուգեք ձեր դիզայնը

          • Համոզվեք, որ նախնական այբբենարաններն ու նախնական այբբենարանները, որոնք դուք պատվիրում եք, համապատասխանում են նախատեսված ուղղությանը:
            • Սա հեշտ սխալ է:

            Գտեք օպտիմալ պայմաններ

            Կաղապարային ԴՆԹ-ի Dpn1 մարսողություն

            • Dpn1 սովորաբար պետք է ավելացվի PCR- ի ավարտից հետո կաղապարային ԴՆԹ -ն քայքայելու համար: Սա կնվազեցնի ֆոնային գաղութների թիվը փոխակերպվելիս: Սովորաբար դա անհրաժեշտ չէ, երբ գել մաքրող բեկորները, այնուամենայնիվ, պետք է խուսափել գելի մաքրումից, ինչպես քննարկվում է այստեղ:
              • Սա կաղապարի տեղափոխումից խուսափելու համար է:
                • Եթե ​​ձեր PCR-ների ձևանմուշները կանամիցին վեկտորներ են, և դուք կառուցում եք Կանամիցինի վեկտոր, ապա ձեր փոխակերպիչների մի մասը պարզապես բջիջներ կլինեն, որոնց միջով կաղապարված պլազմիդ(ներ) է իրականացվում: Սա պետք է հիշել հետագայում `ցուցադրման փուլում:
                • Եթե ​​ունեք հատված Amp պլազմիդից և կառուցում եք Կանամիցին վեկտոր, ապա Dpn1 ավելացնելու կարիք չկա:

                0.5 նգ կաղապարային պլազմիդ ՝ 25 uL PCR ռեակցիայի համար, որպեսզի ստացվի իմ ողնաշարը, այնուհետև սյունը մաքրվում է (չի մաքրվում գելով) և չի կատարում Dpn1 մարսողություն: Վարդագույն գաղութները պլազմիդային ձևանմուշն են, որը տանում է սյունակի մաքրումը, հավաքման ռեակցիայի և փոխակերպման փուլին:

                Զգուշացումներ

                • Extraգույշ եղեք, որ օգտագործեք այբբենարանների ճիշտ համադրություն, եթե մի պլազմիդից մի քանի բեկոր եք ուժեղացնում, կամ եթե ձեր նախաներկերը աշխատում են հավաքման համար օգտագործվող կաղապարների վրա:
                  • Օրինակ ՝ ես մի անգամ կտրում էի վեկտորը և օգտագործում էի հիմքերի սխալ համադրություն ողնաշարի համար: Գելի ժապավենը ճիշտ էր թվում (400 bp տարբերությունը 5 kb ողնաշարի վրա նուրբ է), բայց հանգեցնում է հավաքների, որտեղ երկու կարերից միայն մեկն է ճիշտ:

                  Կատարեք բավականաչափ մաքրման և հավաքման համար

                  • Գործարկեք մաքրման մասշտաբի ռեակցիաներ ՝ հավաքման համար ԴՆԹ պատրաստելու համար
                    • Եթե ​​ձեր արտադրանքը հատուկ է և կարիք չունի գել մաքրելու. (Անհրաժեշտ է միայն PCR մաքրում)
                      • Ուժեղ ուժեղացված ներդիրի 20 ուլտրաժը շատ է: Մի փոքր ավելին արեք (30 ուլլ), եթե դա ողնաշարն է: Այս քանակները սովորաբար տալիս են մեծ քանակությամբ ԴՆԹ 5+ հավաքների համար, ինչը հնարավորություն է տալիս բազմակի փորձերի համար:
                      • աշխատեք ավելի շատ, քան 60-120 լիտր ՝ կախված այն բանից, թե որքան վատ են ենթամթերքները:

                      Մաքրել PCR բեկորները

                      • PCR- ի արտադրանքը մաքրելու լավագույն միջոցը սյունակի պարզ մաքրումն է: Մենք օգտագործում ենք Qiagen PCR մաքրման հավաքածուն և մաքրվում ջրի մեջ:
                        • Սա սովորաբար պահանջում է, որ ձեր PCR- ները շատ հատուկ լինեն ձեր ուզած խմբի չափին: Սա է պատճառը, որ PCR պրայմերները կատարվում են 70 o C հալման ջերմաստիճանի դեպքում. բարձր ջերմաստիճանում (67-70 o C) կռում կատարելը ամենահավանական միջոցն է ձեզ ցանկալի PCR ուժեղացում տալու համար: Դուք պետք է ստուգեք
                        • Սա կհեռացնի այբբենարանի դիմերները և անցանկալի շերտերը: Unfortunatelyավոք, սյունակի վրա հիմնված գելի արդյունահանման հավաքածուները չափազանց ցածր արդյունավետություն ունեն: Դուք կարող եք զտել ջրի մեջ կամ հավաքածուի կողմից տրամադրված բուֆերի մեջ (ենթադրելով, որ այն ընդամենը 10 մՄ տրիս է, pH 8,5 և ուժեղացուցիչը չունի EDTA), բայց ես միշտ ջուր եմ օգտագործել:
                        • Լվացեք 30 մլ (ոչ 50 մլ)՝ խտացված արտադրանք ապահովելու համար:

                        100 uL PCR արտադրանքը սովորաբար տալիս է

                        Nano Drop PCR բեկորներ

                        • Գործարկեք 1,5 մլ NanoDrop մեքենայի վրա՝ յուրաքանչյուր լուծույթի ԴՆԹ-ի կոնցենտրացիան մոտավոր գնահատելու համար:
                        • Դուք կարող եք օգտագործել մեքենայի վրա գործածվող 1.5 լ ծավալը ագարոզե գելի մեջ `հաստատելու համար, որ արտադրանքը լավ տեսք ունի և պատահաբար չի խառնվել մաքրման ընթացքում:
                        • Օրինակ:

                        Գիբսոնի հավաքման արձագանքը

                        • ավելացրեք ձեր մաքրված PCR արտադրանքները և ավելացրեք ջուր, որպեսզի հասնեք ցանկալի կոնցենտրացիայի, ինչպես նշված է ձեր առևտրային հավաքածուով կամ տնային պատրաստման բաղադրատոմսով:
                          • Առևտրային հասանելի հավաքածուն աշխատում է

                          Փոխակերպում

                          • Սովորաբար օգտագործվում է էլեկտրոպորացիա, քանի որ այն կարող է ձեզ շատ ավելի բարձր արդյունավետություն տալ: Այնուամենայնիվ, որոշ մարդիկ օգտագործում են քիմիապես իրավասու բջիջներ, որոնք կարող են բավարար լինել, եթե հավաքումն ավելի պարզ լինի: Որքան ԴՆԹ եք փոխակերպում, և արդյոք անհրաժեշտ է այն նախ աղազերծել, կախված է հավաքման ձեր ակնկալվող արդյունավետությունից և արտադրանքի թունավորությունից:
                          • ԴՆԹ-ի աղազերծումը միլիպորային ֆիլտրերի վրա 15 րոպե նշանակում է, որ դուք կարող եք ավելի շատ ԴՆԹ ավելացնել էլեկտրոպորացիաներին և աղեղներ չունենալ:
                            • Մենք օգտագործում ենք Millipore աղազերծման թուղթ, ապրանք # VSWP01300 ՝ աղազերծելու համար 12-20 uL ռեակցիաներ և Millipore # VSWP02500 ՝ ավելի մեծ ծավալների համար: Ամբողջ հավաքածուն դրեք ֆիլտրի վրա, որը լողում է ջրի վրա:
                            • Ահարոն Պուրին սպասում է 15 րոպե աղազերծման, և առանց էլեկտրական հոսանքի էլեկտրահաղորդվում է 1.6 կՎ լարման դեպքում: -6/2015: Ոչ մի վնաս չկա նրանց ավելի երկար թողնել:

                            • Կարող է լինել շատ ավելի արդյունավետ, քան քիմիապես իրավասու բջիջները:
                            • Օգտագործեք

                            • Եթե ​​դուք օգտագործել եք կոմերցիոն հավաքման խառնուրդը, և ձեր դիզայնը (ա) չափազանց բարդ չէ (չափազանց շատ կտորներ, չափազանց մեծ վերջնական արտադրանք, գեների համար չափազանց թունավոր) և (բ) վերածվում է շատ լավ (կենտրոնացված) էլեկտրակոմպետենտ բջիջների, ապա 1-2 լիտր կարող է ձեզ տալ բավականաչափ գաղութներ ՝ սիզամարգ ունենալու համար:
                            • Դուք գուցե ցանկանաք վերափոխել ոմանց չ-հավաքված բեկորներ, հասկանալու համար, թե որն է իրական վերափոխման նախապատմությունը: (Փոխակերպման ափսեի վրա աճող որոշ գաղութներ կունենան ձևանմուշ ԴՆԹ, այլ ոչ թե ձեր ցանկալի կառուցվածքը, չնայած Dpn1 մարսմանը:
                            • Եթե ​​դուք պլաստմասսա եք սփռում, որը տալիս է ամպիցիլինի դիմադրություն, ափսեը դրեք կարբենիցիլինի վրա, ոչ թե ամպիցիլինի:
                              • Ամպիցիլինը տխրահռչակ է արբանյակային գաղութներ կամ նույնիսկ ոչ դիմացկուն բակտերիաների սիզամարգեր տալու համար: Սա հատկապես խնդիր է, եթե ձեր հավաքված պլազմիդը հանգեցնում է դանդաղ աճի, քանի որ ոչ դիմացկուն բակտերիաները շատ ժամանակ կունենան ծաղկելու համար: Եթե ​​ձեր էլեկտրակոմպետ բջիջները լավն են, ապա բջիջների բարձր խտությունը, ամենայն հավանականությամբ, կհանգեցնի Amp- ի ափսեի բակտերիաների սիզամարգին, նույնիսկ եթե մանրէների մեծամասնությունը Amp- ին դիմացկուն չեն: Դուք կարող եք ձեր էլեկտրոպորացիայի մի փոքր հատվածը տեղադրել Amp- ի վրա, բայց դա ենթադրում է, որ դուք ունեք հավաքման բարձր արդյունավետություն և ցածր բեռի պլազմիդ (օրինակ ՝ մեղմ խթանող + RFP, ոչ բարձր ուժի խթանող և բազմաթիվ ֆերմենտներ):

                              Scուցադրություն ՝ Colony PCR

                              Օգտագործեք գաղութի PCR ՝ PCR բեկորներ ստեղծելու համար, որոնք կհաստատեն ձեր հավաքումը:

                              • Մի օգտագործեք Phusion- ը դրա համար, դա չափազանց արժեքավոր է:
                              • Ես օգտագործում եմ [2X OneTaq http://www.neb.com/nebecomm/products/productM0486.asp] PCR խառնուրդը մի քանի պատճառներով.
                                • Էժան է
                                • Այն կարելի է պահել սառնարանում, հալեցնելով, ամիսներ շարունակ առանց վնասելու։
                                • Այն արդեն ունի բեռնման ներկ, ուստի դիտման համար ագարոզայի գելերի մեջ բեռնումն արագացված է:
                                • Հուշում. Պատրաստեք մոտ 1/2 մլ ջրի և գաղութային PCR պրայմերներ համապատասխան համամասնություններով վերջնական 1x խառնուրդի համար: Տեսեք այս աղյուսակը `խառնուրդի համամասնությունների համար: Շարունակեք և պատրաստեք 1/2 մլ, գուցե ուրախ լինեք, որ հետագայում ավելացրեք, և ջուրը/այբբենարանները գրեթե անվճար են: Մնացած մնացորդները կարող եք անվերջ պահել սառնարանում: Ես նշում եմ OneTaq 212 213 իմը, եթե ես խառնում եմ 212 և 213 այբբենարանների վրա: Այնուհետև, երբ կատարում եք գաղութի PCR, կարող եք այս խառնուրդից ավելացնել 6 uL յուրաքանչյուր ջրհորի, լուծարել բջիջները յուրաքանչյուր ջրհորի մեջ և վրան ավելացրեք 2x խառնուրդի 6uL:
                                • Որպես այլընտրանք, դուք կարող եք 1 անգամ խառնուրդ պատրաստել (ավելացնել անհրաժեշտ ջուրը և պրայմերները) և օգտագործել խառնուրդը սառեցման-հալման բազմաթիվ ցիկլերից հետո:
                                • PCR տարածքի վրա, որն ունի տարբեր երկարություն, քան ձեր կաղապարային պլազմիդներից որևէ մեկը: Սա թույլ կտա ձեզ ասել, թե որոնք են հաջող հավաքույթները, և որոնք են կաղապարների փոխանցումը:
                                  • Եթե ​​պլազմիդի մեջ գեն եք փոխել, և գենի չափն այլ է, PCR այս շրջանի երկարության համար:
                                    • Դուք կարող եք PCR ամբողջ ներդիրով, եթե տեղադրեք դատարկ վեկտորի մեջ, և ձեր ձևանմուշները չեն ուժեղացվի արտադրանքի նույն չափերը տալու համար:
                                    • Դուք կարող եք որոշել վերարտադրել այն գաղութները, որոնք փորձարկվել եք ձեր արդյունքների հայտնվելուց առաջ կամ հետո: Ես միշտ մեկ անգամ վերսկսում եմ՝ նպատակ ունենալով ստանալ միայնակ գաղութներ՝ նվազեցնելու հավանականությունը, որ իմ մինի պատրաստուկը կլինի խառը պոպուլյացիա:
                                      • Ես ափսե եմ անում միևնույն ժամանակ նմուշառում, եթե՝
                                        • Կարծում եմ, որ այն հատվածները, որոնք հաջողակ են (ոչ կաղապար), կլինեն բարձր
                                        • Ես PCR- ն աշխատում եմ մեկ գիշերվա ընթացքում և մինչև առավոտ արդյունք չեմ տա:
                                        • Կարծում եմ, որ արդյունքները կլինեն հիմնականում կաղապարային պլազմիդի փոխանցման միջոցով
                                        • Ես հնարավորություն կունենամ PCR- ի արտադրանքը գել օգտագործել մեկնելուց առաջ, ինչը թույլ կտա ինձ միայն վերստին խոսել «հաղթողների» մասին:
                                        1. Որոշեք, թե քանի գաղութ եք ցանկանում ցուցադրել: Պատրաստեք PCR շերտ (կամ շերտեր) `հորերի համարակալված և համապատասխանող գաղութի համարներին:
                                          1. Ես օգտագործում եմ 12-անոց հավաքածու(ներ), քանի որ իմ ագարոզայի գելերն ունեն բավարար երթուղիներ այս և երկու սանդուղքի համար: Դուք կօգտագործեք ջրհորներից առնվազն մեկը ՝ ձևանմուշ ԴՆԹ -ն որպես հսկողություն ուժեղացնելու համար: Ես ավելի շատ գաղութներ եմ անում (մինչև 33-34), եթե ակնկալում եմ, որ ձևանմուշի փոխանցումը խնդիր կլինի, կամ եթե գեները թունավոր են, և հաջողված հավաքածուները բջիջներն անառողջ են դարձնում:
                                          2. Եթե ​​դուք վերականգնում եք փորձարկված յուրաքանչյուր գաղութ, ապա պատրաստեք ձեր թիթեղները հիմա: Ես ափսեը բաժանում եմ 6 կարկանդակի կտորների։
                                          1. Եթե ​​սկզբում վերալիցքավորեք, նշեք նաև կարկանդակի հատվածների հատվածները այս նույն թվերով:
                                          1. Եթե ​​հիմա վերագտնում եք գաղութները. մի փոքր սրբեք գաղութը ափսեի վրա, ապա մնացածը լուծեք համապատասխան համարակալված PCR-ի մեջ:
                                          2. Եթե ​​այժմ գաղութներ չեք վերականգնում, փորձեք մի քիչ կենսազանգված թողնել ափսեի վրա, բայց վստահ եղեք, որ միշտ բջիջներ են մնացել, եթե իսկապես ագարոզայի մեջ անցք չեք բացել:
                                          3. Հնարավոր է ծանրաբեռնել այն, եթե դուք իսկապես մեծ գաղութներ ունեք և շատ ծծում եք պիպետտի ծայրով:
                                          4. Երբ տվյալ PCR հորատանցքը գաղութ է լուծարվում դրա մեջ, պիպետտի ծայրը դուրս հանեք դրա հետևում գտնվող ջրհորի մեջ: Բացի այն, որ յուրաքանչյուր ջրհոր համարակալված է, և գաղութները համարակալված և շրջապատված են փոխակերպման ափսեի վրա, սա լրացուցիչ երաշխիք է `ապահովելու համար միայն մեկ գաղութ յուրաքանչյուր ՊՇՌ ռեակցիայի մեջ:

                                          Հաջորդականացում

                                          • Ընտրեք 2-4 գաղութ՝ գաղութների PCR-ի հիման վրա հաջորդականության համար
                                          • Սկզբում հերթագրեք Գիբսոնի հավաքման կարերը:
                                          • Մյուս շրջանների հաջորդականությունը, քանի որ հնարավոր է PCR սխալ է մտցվել
                                            • Սովորաբար, երբ «սխալ» է հայտնաբերվում, այն իրականում առկա էր կաղապարի վրա:

                                            Gibson Assembly- ի համար այբբենարանների նախագծում MacVector 17 -ով

                                            MacVector 17-ն ունի բոլորովին նոր գործիք լիգազից անկախ կլոնավորման ռազմավարությունների ավտոմատացված նախագծման համար: Գործիքը աջակցում է 5' էկզոնուկլեազով պայմանավորված Gibson հավաքմանը, ինչպես նաև T4 DNA Polymerase 3' exonuclease «Ligase Independent Cloning» մոտեցմանը: MacVector- ը կարող է ինքնաբերաբար նախագծել այբբենարաններ, երբ դուք նշում եք օգտագործման համար բեկորներ և վեկտորներ: Դուք կարող եք տրամադրել հատուկ այբբենարաններ (ձեռքով կամ այնպիսի գործիքներից, ինչպիսիք են NEBuilder կայքը): Դուք կարող եք նաև պարզապես տրամադրել գոյություն ունեցող բեկորներ համընկնող ծայրերով MacVector-ի հավաքման համար: Ինտերֆեյսը ցույց է տալիս բեկորների միջև հանգույցների ճշգրիտ կառուցվածքը, ներառյալ համապատասխան CDS թարգմանությունները `սպիտակուցների միաձուլման շրջանակը հաստատելու համար: Կլոնավորման ռազմավարությունը կարող է պահպանվել որպես նոր կլոնավորման ծրագրի փաստաթուղթ և վերջապես ինքնաբերաբար հավաքվել մեկ հաջորդականության մեջ `արտահանման համար:

                                            MacVector 17 -ը թողարկվել է 2019 -ի փետրվարին: Այն պարունակում է գենոմների համեմատության բոլորովին նոր գործիքներ, որոնք դյուրացնում են սահմանափակող ֆերմենտների կլոնավորումը, Gibson/LIC- ի կլոնավորման ռազմավարությունների ավտոմատացված դիզայնը, ընդգծում հավաքների խնդիրները, համեմատում բազմաթիվ հաջորդականությունների տվյալների հավաքածուն մեկ հղման հետ և պլազմիդային քարտեզներ դարձնում: գեղեցիկ, ցուցադրելով ձեր սեփական այբբենարանների պարտադիր կայքերը: Վերջապես, MacVector 17-ն աջակցում է macOS Mojave-ի մութ ռեժիմին, որպեսզի օգնի կենտրոնանալ ուշ գիշերային այբբենարանի ձևավորման նիստերի վրա:


                                            Կատարման տվյալներ

                                            Տեսեք, թե ինչպես է NEBuilder HiFi- ն գերազանցում NEB Gibson վեհաժողովին:

                                            Բարելավված արդյունավետություն և ճշգրտություն

                                            Բարելավված հավատարմություն

                                            Այս ապրանքներից մեկը կամ մի քանիսը ծածկված են արտոնագրերով, ապրանքային նշաններով և/կամ հեղինակային իրավունքներով, որոնք պատկանում կամ վերահսկվում են New England Biolabs, Inc.-ի կողմից: Լրացուցիչ տեղեկությունների համար խնդրում ենք ուղարկել մեզ էլեկտրոնային նամակ [email protected] հասցեով: Այս ապրանքների օգտագործումը կարող է ձեզանից պահանջել ստանալ երրորդ կողմի լրացուցիչ մտավոր սեփականության իրավունքներ որոշակի հավելվածների համար: .

                                            GIBSON ASSEMBLY & reg- ը գրանցված ապրանքային նշան է Synthetic Genomics, Inc.


                                            Դիտեք տեսանյութը: ՍՈՎՈՐՈՒՄ ԵՆՔ ՌՈՒՍԵՐԵՆ (Հունվարի 2023).