Տեղեկատվություն

Որքա՞ն արագ են տարբեր օրգաններ շրջում բջիջները:


Ասում են, որ մարդու մարմինը 7 տարվա ցիկլերում շրջում է բոլոր բջիջները կամ մոլեկուլները։ Սա այնքան էլ ճիշտ չէ, քանի որ կան տարբեր օրգաններ, որոնք փոխվում են տարբեր արագությամբ: Իմ հետաքրքրությունն այն է, թե որն է փոփոխության սանդղակը և հատկապես ՝ հնարավո՞ր է չափել և որքան արագ դա անել.

1) բջիջները փոխվում են

2) մոլեկուլները փոխվում են

3) ատոմները փոխվում են

Բարձր, միջին և առավելագույն արագության օրգանների օրինակները կգնահատվեն:


1) բջիջների աճ

Դուք պետք է նայեք քիմիաթերապիային և ընդհանրապես քաղցկեղի բժշկությանը: Քանի որ քիմիան հիմնականում արդյունավետ է, քանի որ այն սպանում է արագ բաժանվող բջիջները, սա բավականին լավ է մշակվել: 7-10 տարվա թիվը իրականում ճիշտ չէ, որոշ բջիջներ փոխարինվում են շատ ավելի դանդաղ:

Ահա թե ինչու մազերը հաճախ ընկնում են քաղցկեղի բուժման ժամանակ, քանի որ ֆոլիկուլային բջիջներն արագ աճում են: Նեյրոնները շատ դանդաղ են բաժանվում, եթե ընդհանրապես, և հաճախ երբեք չեն փոխարինվում: Ճարպի բջիջները արանքում են, հավանաբար փոխարինվում են 7-10 տարվա ընթացքում: Սրտի բջիջները փոխարինվում են թեև բավականին դանդաղ ՝ տարեկան 1% -ից պակաս, ինչը նշանակում է, որ շատ բջիջներ ձեզ հետ են ձեր ողջ կյանքի ընթացքում:

2) ատոմները/մոլեկուլները փոխվում են

Բջիջն ինքնին գտնվում է շարունակական հոսքի վիճակում, սակայն բջջի տարբեր մասերը, ինչպես մարմնի բջիջները, փոխվում են տարբեր արագությամբ: Որոշ սպիտակուցներ, որոնք կազմում են բջջի մատրիցը կամ միջուկի ԴՆԹ-ն, փոխարինվում են շատ հազվադեպ (օրինակ՝ քրոմոսոմի վերանորոգման կամ վերադասավորման միջոցով), և քրոմոսոմի ԴՆԹ-ի մեծ մասը բջջի հետ է բջջի ողջ կյանքի ընթացքում:

Սպիտակուցների մեծամասնությունը պիտակավորված են քայքայման համար և վերամշակվում են մի քանի ժամ աշխատելուց հետո: Մետաբոլիկ միացությունները, ինչպիսիք են շաքարավազը կամ աղը, կարող են անընդհատ սողալ և դուրս գալ բջիջից, գուցե շրջվել մոտ մեկ ժամից: Atsարպերը կարող են ներառվել բջջի մեջ և, կարծում եմ, տարիներ շարունակ պահպանվում են:


Գիտնականները պարզում են, թե ինչպես են մաշկի և օրգանների երեսպատման բջիջները պահպանում բջիջների մշտական ​​թիվը

SALT LAKE CITY - Այսօր հրապարակված հետազոտություն Բնություն Յուտայի ​​համալսարանի Հանթսմանի քաղցկեղի ինստիտուտի (HCI) գիտնականները ցույց են տալիս, թե ինչպես են էպիթելի բջիջները, ինչպիսիք են մաշկի բջիջները, բնականաբար շրջվում ՝ պահպանելով բջջային բաժանման և բջիջների մահվան միջև մշտական ​​թվեր:

Բացի մաշկից, էպիթելի բջիջները ներառում են մաշկի նման երեսպատում, որոնք ծածկում են ներքին օրգանները ՝ օրգաններին տալով պաշտպանիչ պատնեշ, որպեսզի նրանք կարողանան ճիշտ գործել: Էպիթելիայում բջիջները շատ արագ շրջվում են: Բջիջների առողջ խտությունը պահպանելու համար հավասար թվով բջիջներ պետք է բաժանվեն և մահանան: Եթե ​​այդ հավասարակշռությունը հանվի, կարող են բորբոքային հիվանդություններ կամ քաղցկեղ առաջանալ:

Ուսումնասիրության ղեկավար Phոդի Ռոզենբլատը, բ.գ.դ., հետազոտող HCI- ում և Յուտայի ​​համալսարանի ուռուցքաբանական գիտությունների դոցենտ, ասում է. Մյուս կողմից, եթե շատ բջիջներ բաժանվում են մահացող թվի համեմատ, դա կարող է առաջացնել բջիջների գերբարձրացում, ինչը կարող է հանգեցնել ուռուցքի ձևավորման: Այսպիսով, երկու կողմերի անհավասարակշռությունը խնդրահարույց է »:

Քաղցկեղի մոտ 90 տոկոսն առաջանում է պարզ էպիթելիայում, որը ծածկում է օրգանները: Հասկանալը, թե ինչն է սովորաբար վերահսկում բջիջների բաժանումը և մահը և ինչպես են այդ գործընթացները կապված, էական է հասկանալու համար, թե ինչպես են այդ իրադարձությունները սխալ կարգավորվում քաղցկեղի առաջացման համար: Թեև գիտնականները նախկինում ուսումնասիրել էին բջիջների բաժանումը և մահը ՝ ի պատասխան փորձարարական գործոնների, սակայն այն, թե ինչպես են այդ գործընթացները բնականաբար տեղի ունենում, ավելի քիչ պարզ էր:

HCI թիմը գտավ այս հանելուկի պատասխանը: Նրանք իմացան, որ հակառակ մեխանիկական լարվածությունը վերահսկում է ինչպես բջիջների բաժանումը, այնպես էլ բջիջների մահը: Մասնավորապես, նրանք պարզել են, որ էպիթելային բջիջների ձգվելը հանգեցնում է նրանց բաժանման, իսկ էպիթելային բջիջների կուտակումն առաջացնում է նրանց արտաքսում և մահ:

«Մենք գիտեինք, որ պետք է ինչ-որ կանոնակարգում լինի մահվան և բաժանման գործընթացները միմյանց հետ կապելու համար», - ասում է Ռոզենբլատը: «Այն, ինչ մենք գտանք, հիմնված է իսկապես պարզ սկզբունքների վրա: Այս ամենը մեխանիկական լարվածություն է: Եթե բջիջները չափազանց մարդաշատ են, 1,6 անգամ ավելի մարդաշատ, ապա դրանք դուրս են հանում որոշ բջիջներ, որոնք հետագայում մահանում են: Բջիջների արտամղումը հնարավորություն է տալիս բջջային թերթերին վերադառնալ: իրենց դուր եկած խտություններին »:

Մյուս կողմից, հետազոտողները նկատեցին, որ բջիջները բաժանվում են ավելի նոսր տարածքներում: Նրանք հասկացան, որ այդ նոսր շրջանները լարվածություն են ստեղծում բջիջների վրա, որոնք ձգվում են:

«Եթե բջիջները չափազանց նոսրանում են, ապա նրանք ակտիվացնում են բջիջները բաժանվելու համար, և որ բաժանման ազդանշանը գալիս է մեխանիկական ձգումից», - բացատրում է Ռոզենբլատը: «Սա փորձարկելու համար մենք ձգեցինք բջիջները և պարզեցինք, որ ձգումը կարող է բջիջների բաժանման պատճառ դառնալ ընդամենը մեկ ժամվա ընթացքում: Գործընթացը նաև ցույց տվեց մեզ, որ ձգումը բջիջների բաժանման նորմալ գործարկիչ է»:

Ռոզենբլատի թիմը վերլուծել է մարդու հաստ աղիքի բջիջները, զեբրաձկան բջիջները և շների բջիջների կուլտուրաները: Այն վայրերը, որտեղ բջիջները բաժանվում էին, միշտ ավելի ձգված էին `1,6 անգամ ավելի ձգված, ինչպես բջիջների մահվան հարաբերակցությունը:

Հաջորդ հարցը պարզելն էր, թե ինչով է պայմանավորված այս գործընթացները: Ռոզենբլատի թիմը պարզել է, որ և՛ բջիջների բաժանումը, և՛ մահը վերահսկվում են միևնույն սպիտակուցի ՝ Piezo1- ի միջոցով:

«Հիմնականում այս նույն սպիտակուցը զգում է ինչպես կուտակում, այնպես էլ ձգում, բայց արդյունքը շատ տարբեր է` կախված այն բանից, թե ինչ վիճակում են գտնվում բջիջները », - ասում է Ռոզենբլատը: «Piezo1- ը մի տեսակ նման է թերմոստատի, որը կարգավորում է երկու տարբեր կողմեր: Ինչպես և ջերմոստատը կարգավորում է և՛ ջերմությունը, և՛ ցուրտը, իմաստ ունի ունենալ մեկ սենսոր, որը չափում է կուտակումն ու ձգումը: Եթե երկու առանձին կարգավորիչ լիներ, ամեն ինչ կարող էր արդարացիորեն դուրս գալ վերահսկողությունից: արագ, եթե մեկ սենսոր կոտրվի »:

Բացի հասկանալուց, թե ինչպես է Piezo1-ը ներգրավված կարգավորման մեջ, Ռոզենբլատի թիմը նաև հայտնաբերել է բջջային ցիկլի մի փուլ, որտեղ բջիջները կանգ են առնում վերանորոգման համար:

«Մենք միշտ ենթադրել ենք, որ երբ բջիջները սկսում են բաժանման ցիկլը, նրանք պարզապես անցնում են: Մենք չգիտեինք, որ դրանք ընդմիջում են ամբողջ բջջային ցիկլի ընթացքում», - բացատրում է Ռոզենբլատը: «Բայց մենք գտանք մի կետ, որտեղ բջիջները պարզապես կանգ էին առել՝ սպասելով բաժանման: Շատ բաներ պետք է տեղի ունենան, որպեսզի բջիջները բաժանվեն: ԴՆԹ-ն պետք է կրկնօրինակվի, որպեսզի այն կարողանա կիսով չափ կիսվել՝ յուրաքանչյուր նոր բջիջ ապահովելով նույն ԴՆԹ-ով, ինչ ծնողը: Այս բջիջներն ամեն ինչ պատրաստ են դա անելու համար, բայց նրանք դեռ այնտեղ կանգ են առնում մի քայլի վրա, որը մենք չէինք սպասում, որ կկարգավորվի: Բջիջները կարող են կանգ առնել `որոշակի չափի հասնելուն պես: Երբ հասնեն այս չափին, ձգումը նրանց դրդում է բաժանել »:

Հասկանալով, թե ինչպես են բջիջները սովորաբար ինքնուրույն բաժանվում, Ռոզենբլատը կարծում է, որ գիտնականներն ավելի լավ պատկերացում կունենան, թե ինչպես են էպիթելային բջիջները բաժանվում, երբ չպետք է, ինչպես քաղցկեղը:

«Հասկանալով, թե ինչպես են բջիջների մահը և բաժանումը սովորաբար կարգավորվում», - բացատրում է նա, «մենք հայտնաբերում ենք այս գործընթացների սխալ ընթացքի նոր ուղիներ, հատկապես այն հիվանդությունների դեպքում, որոնց բուժումը ներկայումս չունենք, ասթմայի և մետաստատիկ քաղցկեղի դեպքում»:

Այս ուսումնասիրությունը ֆինանսավորվել է Առողջապահության ազգային ինստիտուտի տնօրենի նոր նորարար մրցանակի և Յուտայի ​​համալսարանի ֆինանսավորման խթանման դրամաշնորհի կողմից՝ Քաղցկեղի ազգային ինստիտուտի և Huntsman Cancer Foundation-ի լրացուցիչ աջակցությամբ:

Յուտայի ​​համալսարանի Հանթսմանի քաղցկեղի ինստիտուտը (HCI) աշխարհի առաջատար գիտական ​​հետազոտությունների և քաղցկեղի բուժման կենտրոններից է: HCI- ն ղեկավարում է Յուտայի ​​բնակչության տվյալների շտեմարանը `աշխարհի ամենամեծ գենետիկական տվյալների շտեմարանը, որն ունի ավելի քան 16 միլիոն գրառում` կապված ծագումնաբանությունների, առողջապահական գրառումների և կենսական վիճակագրության հետ: Օգտագործելով այս տվյալները, HCI- ի հետազոտողները հայտնաբերել են քաղցկեղ առաջացնող գեներ, ներառյալ մելանոմայի, հաստ և կրծքի քաղցկեղի պատասխանատու գեները: HCI- ն Քաղցկեղի դեմ պայքարի ազգային համապարփակ ցանցի (աշխարհի 27 առաջատար քաղցկեղի կենտրոնների դաշինք) անդամ է և Քաղցկեղի ազգային ինստիտուտի կողմից նշանակված քաղցկեղի համապարփակ կենտրոն է: HCI- ն բուժում է քաղցկեղի բոլոր ձևերով հիվանդներին և գործում է մի քանի բարձր ռիսկային կլինիկաներ, որոնք կենտրոնանում են մելանոմայի և կրծքի, հաստ և ենթաստամոքսային գեղձի քաղցկեղի վրա: Հիվանդների և հանրային կրթության HCI քաղցկեղի ուսուցման կենտրոնը պարունակում է քաղցկեղի հետ կապված հրապարակումների ազգի ամենամեծ հավաքածուներից մեկը: Ինստիտուտը կրում է Յուտա նահանգի բարերար, արդյունաբերող, քաղցկեղը վերապրած onոն Մ. Հանթսմանի անունը:

Հրաժարում. AAAS և EurekAlert! պատասխանատվություն չեն կրում EurekAlert- ում տեղադրված լրատվական հրապարակումների ճշգրտության համար: ներդրում կատարող հաստատությունների կամ EurekAlert համակարգի միջոցով ցանկացած տեղեկատվության օգտագործման համար:


Բջջային շրջանառությունը «առողջ մաշկի սուրբ գրալն է», բայց ի՞նչ է դա իրականում նշանակում:

Պարզ ասած. “ Բջիջների շրջանառությունը մաշկի մահացած բջիջները թափելու և հետագայում դրանք երիտասարդ բջիջներով փոխարինելու շարունակական գործընթաց է, և ասում է խորհրդի կողմից սերտիֆիկացված մաշկաբան և Curology հիմնադիր, բժիշկ Դեյվիդ Լորտշերը:

Այս գործընթացը առողջ մաշկի «սուրբ գրալն» է, ինչպես ասում է «Union Square Laser Dermatology»-ի գեղագիտության տնօրեն Ռեա Սուլերիս Գրուսը, քանի որ այդ գործընթացը մաշկը դարձնում է ավելի փայլուն և ձիգ, ինչպես նաև ավելի արագ ազատվում բարակ գծերից և կնճիռներից: . Եթե ​​բջջային շրջանառություն չես անում, ապա կուտակումներ ես ունենում, և դա նման է մակերևույթի խցանման, և ասում է Գրուսը: Այդ լճացումը կարող է հանգեցնել այնպիսի խնդիրների, ինչպիսիք են պզուկները, հիպերպիգմենտացիան, միլիան և անհարթ հյուսվածքը:

Որպեսզի հասկանանք, թե ինչու է այս բջիջների շրջանառությունը կարևոր այս խնդիրների լուծման և մաշկի ընդհանուր առողջության համար, ընդհանրապես & mdashlet ’s այն հետ են մղում ավագ դպրոցի կենսաբանություն և մի փոքր ավելի են քանդում իրերը: Ձեր մարմնի յուրաքանչյուր բջիջ ունի կյանքի ցիկլ, իսկ մեծահասակների մաշկի բջիջների դեպքում այդ ցիկլը տևում է մոտ 28 օր: (Դանդաղում է, երբ ծերանում ես, բայց դրա մասին ավելի ուշ): Մաշկի նոր բջիջները ծնվում են ձեր դերմիսի ամենախորը շերտում, որը կոչվում է բազալ շերտ: Հասունանալով նրանք էպիդերմիսի միջով շարժվում են դեպի մաշկի մակերեսը: Այս գործընթացի ընթացքում ինչ -որ պահի նրանք կորցնում են իրենց միջուկները, ինչը նշանակում է, որ նրանք այլևս ակտիվ, կենդանի բջիջներ չեն: Նրանք դառնում են մահացած բջիջների խիտ շերտ, և ժամանակի ընթացքում նրանք դուրս են մղվում, և ասում է, որ խորհրդի կողմից սերտիֆիկացված մաշկաբան asonեյսոն Միլլերը, բժիշկ:

Երբ այս հին բջիջները թափվում են, նորերը բարձրանում են մակերես ՝ իրենց տեղը գրավելու համար: & Քանի որ մակերևույթի վերևի տղան մահանում է, այն բաց է թողնում ներքևի հաստլիկ տղայի համար `ասելու ‘ իմ հերթը, ’ և փոխարինելու նրան վերևում, ”, - ասում է Գրոսը: Եվ երբ այդ հաստլիկ մանկական մաշկի բջիջները հասնում են վերևին, այն հրաժեշտ է տալիս ձանձրալի մաշկին և բարև՝ առողջ, փայլուն դեմքին:

Լուսանկարը ՝ W+G Creative

Թեև ձեր մաշկը կարող է ինքնուրույն կարգավորել բջիջների շրջանառության գործընթացը, և վերջիվերջո, մաշկի նոր բջիջներն ինքնուրույն կբարձրանան, իսկ հները կթափվեն և կան որոշ բաներ, որոնք դուք կարող եք անել, որպեսզի այն ավելի արագ կատարվի: Այստեղից է գալիս շերտազատումը: “Ձեր մաշկը անցնում է բջիջների շրջանառության միջով, անկախ նրանից, թե դուք շերտազատում եք, թե ոչ, բայց այն, ինչ վերջում տեղի է ունենում, այն է, որ բջիջներն անջատվում են մաշկից և սկսում կուտակվել միմյանց վրա, 8221-ն ասում է Ռեյչել Լիվերմանը, գլխավոր տնօրեն և Glowbar մաշկի խնամքի կենտրոնի համահիմնադիրը: Ի տարբերություն օձի, որը թափում է իր մաշկը, մենք պարզապես չենք սողում և թողնում մեծ երկար կեղևը ետևում: ”

Դուք կարող եք ավելի արագ օգնել ձեր մաշկին և քսել քիմիական կամ մեխանիկական մաքրող միջոցներով, որոնք տարբեր կերպ են կատարում աշխատանքը: Եթե ​​դուք խանգարում եք գործընթացին, բջջային շրջանառությունը խրախուսվում է, և ասում է Լիվերմանը: Քիմիական շերտազատող նյութերը, ինչպիսիք են գլիկոլաթթուն, փոխազդում են մահացած բջիջների և մաշկի միջև եղած կապերի հետ, ինչը օգնում է թուլացնել բջիջները և դրդում նրանց ընկնելուն: Մեխանիկական շերտազերծիչները (մտածեք. Մացառներ) քսում են մաշկի վերին շերտը այնքան ուժեղ, որ ֆիզիկապես հեռացնեն մաշկի մահացած բջիջները: Երկու դեպքում էլ այդ մռայլ նոր բջիջները դուրս կգան վերևից:

Լուսանկարը ՝ W+G Creative

Բջջային շրջանառության իրական ոսկու ստանդարտ բաղադրիչը, սակայն, ռետինոլն է: Ռետինոլն ամբողջ գործընթացը դնում է արագ առաջընթացին, և ասում է բժիշկ Միլերը: Դա ստիպում է մաշկի միջոցով բջիջների առաջընթացը և վերին շերտի մաքրումը մի փոքր ավելի արագ է տեղի ունենում: ծերացող մաշկի դեպքում, ”, - ասում է դոկտոր Լորտշերը: Հարկ է նշել, որ սա է պատճառը, որ շատ մաշկաբաններ խորհուրդ են տալիս ռետինոլ ավելացնել ձեր առօրյային մինչև 20-ականների վերջը:

Եվ ծերացումը այն ամենը չէ, ինչ նրանք կարող են օգնել: Ռետինոլը (և ռետինոիդները, նրանց Rx գործընկերները) խիստ խորհուրդ են տրվում պզուկոտ մաշկի համար, քանի որ շատերը, որոնք խցանում են ծակոտիները, ստեղծում են բշտիկներ և կիսում մաշկի այդ մակերևույթին կախված մաշկի այդ մահացած բջիջները: “Երբ դուք ստիպում եք բջիջների շրջանառությունը մի փոքր ավելի արագ տեղի ունենալ, դա բացում է այդ ծակոտիները,” ասում է բժիշկ Միլլերը:

Ձեր առօրյայում ռետինոլ ավելացնելու համար փորձեք բոլորի սիրելի դեղատան ադամանդը՝ Differin-ը ($13) կամ մեր մյուս առաջարկվող ապրանքներից մեկը: Եթե ​​դուք ունեք զգայուն մաշկ, բուսական հիմքով բակուչիոլ և mdashlike Herbivore Bakuchiol Natural Retinol Alternative Serum (54 դոլար) և mdashis- ը հիանալի նուրբ այլընտրանք է, ինչպես և Mara Primrose- ը և Green Tea Retinol Oil- ը (120 դոլար):

Ամենալավ բանը, որ պետք է հիշել բջիջների շրջանառության մասին: Քանի որ ձեր բջիջները տեղաշարժվում են յուրաքանչյուր 28 (օր) մեկ օրում, դա նշանակում է, որ թարմ, առողջ մաշկը միշտ գտնվում է մակերևույթի տակ:


Որքա՞ն ժամանակ է պահանջվում ձեր մարմնին 19 տեսակի բջիջների և օրգանների վերամշակման համար՝ ձեր մաշկից մինչև կմախք:

Մարդու մարմինները փոխվում և վերականգնվում են մեր ողջ կյանքի ընթացքում:

Այդ գործընթացը հեշտ է տեսնել, եթե դիտում եք նորածինների վերջույթների աճը և նրանց մարմինների մեծացումը: Ակնհայտ է նաև, երբ ոտքի եղունգները աճում են կամ առողջ մաշկը դուրս է գալիս այրվածքների հեռացումից հետո:

Սակայն օրգանիզմում վերածննդի և վերածնման ոչ այնքան ակնհայտ համակարգերը շարունակվում են հասուն տարիքում: Մաշկի մեռած բջիջները մշտապես բարձրանում են մեր մարմնի մակերես, դուրս են հանվում, այնուհետև փոխարինվում են նոր ցողունային բջիջներով:

Մարմնի որոշ հատվածների երկար թարմացում պահանջվում է. Օրինակ ՝ ճարպերի կուտակման մեր բջիջները տեղաշարժվում են տասը անգամ մեկ անգամ, մինչդեռ մենք ստանում ենք լյարդի թարմ բջիջներ մոտ 300 օրը մեկ անգամ:

Իհարկե, ձեր մարմինը պարզապես չի նետում մի ամբողջ լյարդի բջիջներ 300 -րդ օրը և ստեղծում բոլորովին նոր հավաքածու 301 -ին: Փոխարենը, դա ավելի շատ օրգանական ցիկլ է, քանի որ լյարդի բջիջները շարունակում են բաժանվել և վերածնվել դրանցից շատ ժամանակ անց: կրկին հասունացել.

Այնուամենայնիվ, մարմնի բոլոր մասերը չեն վերականգնվում կամ փոխվում: Մինչ մարմնի մազերը գտնվում են աճի գրեթե անընդհատ վիճակում, մարդու ուղեղի և գլխի մասերը գրեթե ավարտվում են ծնվելուց (ինչպես աչքի ոսպնյակը, որն օգնում է ձեզ կարդալ սա):

Ի վերջո, մեր ԴՆԹ -ի ծայրերը սկսում են մաշվել, քանի որ տարիների մաշվածությունն իրենց վնասն է հասցնում մարմնին `բնական ծերացման գործընթացի մի մաս:

Ահա ընդամենը մի քանի անհամար եղանակներ, որոնցով ձեր մարմինը վերածնում, աճում և սկսում է անընդհատ նորից:

Իհարկե, կենդանական աշխարհի ոչ բոլոր ներկայացուցիչներն ունեն վերածննդի նույն գործընթացները: Ոմանք վայրենի են դառնում իրենց տեխնիկայի հետ.

Մեգան Բարթելսը և Ֆլորենս Ֆուն նպաստեցին այս պատմության ավելի վաղ տարբերակին:


Մաս 2. Էպիթելի ապոպտոզ. Մահ էպիթելի բջիջների արտամղման միջոցով

00: 07.1 Ողջույն:
00: 08.3 Ես odyոդի Ռոզենբլաթն եմ Հանթսմանի քաղցկեղի ինստիտուտից
00: 11.1 Յուտայի ​​համալսարանում,
00: 12.2 և այս հատվածում `էպիթելային բջիջների հոմեոստազի վերաբերյալ,
00: 16.1 մենք կխոսենք այն մասին, թե ինչպես են էպիթելային բջիջները մահանում
00: 19.1 իմ լաբորատորիայի կողմից հայտնաբերված գործընթացի միջոցով
00: 21.0 կոչվում է էպիթելի բջիջների արտամղում:
00: 23.1 Այժմ, պարզապես որպես հիշեցում, էպիթելիան միասին աշխատում է ձևավորման համար:
00: 29.1 այս էպիթելի բջիջները, որոնք տեսնում եք այստեղ, աշխատում են միասին
00:31.1 պաշտպանիչ պատնեշ ձևավորելու համար ոչ միայն ձեր մարմնի համար,
00:33.2 բայց ձեր մարմնի բոլոր օրգանները:
00:35.3 Եվ չնայած նրանք ստատիկ տեսք ունեն,
00:37.3 նրանք շրջվում են շատ արագ տեմպերով
00: 40.0 էպիթելային բջիջների մահվան և բաժանման միջոցով,
00:42.1 ինչպես տեսնում եք այստեղ:
00: 43.2 Այժմ, դա անելու համար նրանք իսկապես կարիք ունեն
00: 47.2 -ը համընկնում է մահացող բջիջների թվերի հետ
00:50.0 բաժանողներին
00:52.0 և, ավելին,
00: 54.1 մենք պետք է հասկանանք, թե ինչպես կարող են էպիթելային բջիջները մահանալ
00: 57.1 ՝ առանց խափանելու այդ ամբողջ պատնեշի գործառույթը:
00: 59.1 Եվ առաջին բանը, որ մենք ուզում էինք հասկանալ, դա է
01: 01.3 արդյոք նրանք կարող են, եթե մենք բջիջները մեռցնենք,
01: 05.1 կարո՞ղ էին նրանք պահպանել մշտական ​​արգելքը,
01: 07.3 որն է նրանց գործառույթը:
01: 09.0 Եվ այսպես անելու համար մենք մշակույթի բջիջներ վերցրինք
01: 13.0 և դրանք զարդարել զտիչի վրա
01:15.1, որպեսզի կարողանանք չափել նրանց էլեկտրական դիմադրությունը,
01:17.2 դուք կարող եք տեսնել այստեղ ժամանակի ընթացքում,
01:19.1 որպես արգելքի ֆունկցիայի չափ:
01: 21.2 Եվ երբ մենք խթանեցինք բջիջների մահը
01: 23.1 կարճ ալիքի ուլտրամանուշակագույն զարկերակով,
01: 25.1 կարող եք տեսնել, որ նրանք կարողանում են պահպանել
01: 29.1 նույն հաստատուն պատնեշը, ինչ կառավարման միաշերտերը,
01:31.2 որտեղ բջիջների մահ չկա:
01: 33.1 Եվ նույնիսկ այս վերջին պահին, այստեղ,
01: 35.2 Այս բջիջների մոտ 50% -ը իրականում մահացած են,
01: 38.0 բայց նրանք դեռ կարողանում են պահպանել ֆունկցիոնալ արգելքը:
01: 41.0 Սա պարզապես ցույց է տալիս, որ խանգարում է պատնեշը
01: 43.2 խաչմերուկները խափանելով
01:47.0 մենք կարող ենք տեսնել այս էլեկտրական դիմադրության շեղումները,
01: 48.2 այնպես որ սա իսկապես աշխատում է,
01:51.0 դա պարզապես ի վիճակի է դա անել:
01: 52.1 Այսպիսով, ինչպե՞ս կարող է այն պահպանել այս պատնեշը:
01:54.2 Եվ ինչպես դա անում է գործընթացի միջոցով, որը
01: 58.2 մենք հայտնաբերեցինք, որը կոչվում է էպիթելի բջիջների արտամղում:
02: 01.1 Այժմ, ինչ կնկատեք այս բջիջներում:
02: 03.0 դրանք պարզապես MDCK բջիջներ են, որոնք մենք բուժել ենք ուլտրամանուշակագույն ճառագայթներով
02: 05.0 բջջային մահվան պատճառ դառնալու համար,
02: 06.3, և երբ նրանք մահանում են, նրանք դուրս են գալիս շերտից,
02: 10.0, և երբ դա անում են, նրանց շրջապատող բջիջները
02:13.1 տեղափոխվեք այն տարածություն, որտեղ ժամանակին եղել է մահացող բջիջը,
02: 15.2 այնպես, որ այս շերտում երբեք բացեր չձևավորվեն:
02: 19.2 Դա անելու համար այս բջիջները ազդանշան են տալիս նրանց շրջապատող կենդանի հարևաններին
02: 24.3 ակտիվացնել ակտինի և միոզինի կծկող օղակի ձևավորումն ու կծկումը,
02: 30.1, որը սեղմում է շուրջը և ներքևը, որպեսզի դրանք դուրս գա լուսատուի մեջ,
02: 34.3 լուսատու տարածություն:
02:36.1 Եվ այսպես, անելով սա,
02: 38.2 նրանք կարողանում են պահպանել այս հաստատուն պատնեշը:
02:41.0 Այսպիսով, երբ մենք առաջին անգամ գտանք սա,
02: 44.1 մենք ցանկանում էինք հասկանալ ազդանշանը, որը կարող է վերահսկել այս գործընթացը,
02:47.1 և կային երկու շատ լայն մոդելներ, որոնք կարող էին վերահսկել դա:
02:51.0 Մեկն այն էր, որ կարող էր լինել:
02: 53.2 բջիջները կարող են զգալ լարվածության փոփոխություն
02:55.3 և որ իրենք կարձագանքեն՝ ձևավորելով սա
02:58.0 ակտին-միոզին մալուխ,
03:00.0, իսկ մյուս միտքն այն էր, որ կարող է փաստացի դրական ազդանշան լինել
03: 02.2 գալիս է այն բջիջից, որը պատրաստվում էր դուրս գալ,
03: 06.0 ՝ ակտինի և միոզինի այս ձևավորումը ակտիվացնելու համար
03: 09.1 բջիջը դուրս մղելու համար:
03: 11.2 Եվ մենք դեռ իսկապես չենք բացառել այս մոդելը,
03: 15.1, և այս մոդելի վրա դեռ կարող են լինել վավեր կետեր,
03: 18.1, բայց այն, ինչ ձեզ ցույց կտամ սլայդների հաջորդ շարքում, դա է
03: 23.0 կա դրական ազդանշան, որն ակտիվացնում է այս մալուխը:
03:25.3 Եվ ինչպես մենք դա բացահայտեցինք
03: 29.1 -ը եղել է անալիզի միջոցով, որը մենք անվանել ենք բջիջների ավելացման անալիզ:
03: 32.1 Այսպիսով, այն, ինչ մենք կանեինք, դա է
03:35.1 արտադրում է ապոպտոտիկ կամ կենդանի բջիջների պոպուլյացիա,
03: 39.2, որոնք պարզապես աճեցվել են առանց ուլտրամանուշակագույն ճառագայթման, այստեղ,
03:43.0, այնուհետև մենք տրիպսինացրինք դրանք
03: 45.2 և նշեք դրանք FITC- լեկտինով
03:47.2 դրանք կանաչ գույնով պիտակավորելու համար,
03: 50.0, այնուհետև դրանք ավելացնում էինք միաշերտին
03: 52.1 և ստուգեք ՝ արդյոք ապոպտոտիկ բջիջները
03: 55.0-ը կարող է առաջացնել այս ակտին-միոսինային հավաքումը, ինչպես մենք տեսանք,
03:57.2 ռինգում.
03: 59.3 Եվ երբ դա անում եք, այն, ինչ տեսնում եք, այս ամբողջ փորձությունն է այստեղ,
04: 02.2 բայց ես այն կբաժանեմ մասերի
04: 05.1, որպեսզի կարողանաք հասկանալ, թե ինչ ենք մենք նայում:
04:07.2 Այսպիսով, նայելով միայն ԴՆԹ ալիքին,
04: 10.2 կարող եք տեսնել, թե արդյոք ավելացված բջիջը կենդանի էր,
04: 13.2 որը մեծ է և անձեռնմխելի, այստեղ,
04: 16.1, արդյոք դա վաղ ապոպտոտիկ փուլերում էր,
04: 19.0, որը նման էր այն բջիջներին, որոնք արտամղվում էին,
04: 23.0 կամ արդյո՞ք այն գտնվում էր հետմշակված հետմահու փուլերում:
04: 26.0 Եվ երբ դուք այժմ նայում եք ակտինային ալիքին
04:28.2 ուղիղ միաշերտ տարածքում,
04: 31.2 Այն, ինչ կարող եք տեսնել, այն է, որ միայն վաղ ապոպտոտիկ բջիջներն են
04: 34.1 -ը կհանգեցնի այս ակտինի հավաքմանը:
04: 36.2 Կենդանի բջիջները դա չեն արել,
04: 38.1, ինչը լավ էր իմանալ, որ դրանք այդպիսին չեն
04: 40.1 բջիջ-բջիջ շփման ձևի ակտիվացում,
04:44.2 և ավելին, ուշ ապոպտոտիկ բջիջները դա չեն արել,
04: 47.1, ինչը հետաքրքիր էր, քանի որ այն նաև հուշում էր դա
04: 49.3 սա ֆագոցիտային բաժակ չէր,
04: 51.2, որը կարող է պատահել, որ կուլ տա ավելացված ապոպտոտիկ բջիջները:
04:55.1 Այսպիսով, սա հուշում էր, որ
04:58.0 սրա արտաքին մակերեսին ինչ-որ բան կար
05:00.2 վաղ ապոպտոտիկ բջիջ, որը եղել է
05: 03.1 առաջացնելով այս ակտին-միոսին մալուխի ձևավորումը
05:05.1 բջիջները դուրս քամելու համար:
05:07.0 Եվ մենք ուզում էինք պարզել, թե ինչ է սա
05:09.2, ուստի մեզ ավելի լավ մեկնարկային նյութ էր պետք:
05: 12.1 Եվ հիմնվելով այն փաստի վրա, որ ոչ միայն վաղ ապոպ.
05: 15.0 ոչ միայն ապոպտոտիկ բջիջները կսեղմվեին,
05:18.0 բայց եթե մենք չափից ավելի ներարկեինք բջիջ
05: 20.2 երբ մենք միկրո ներարկում էինք անում կամ պարզապես դանակ էինք խփում բջիջին,
05:23.1 այդ բջիջները նույնպես կարտամղվեն,
05: 25.1 այնքան նեկրոտիկ բջիջներ, ոչ միայն ապոպտոտիկ բջիջներ,
05: 27.2 -ը կստանա էքստրուդիա:
05: 29.2 Երբ մենք սկսում ենք այս անալիզի նեկրոտիկ բջիջներով,
05:32.2 նրանք ամբողջովին մահացած են,
05: 34.3 նրանք չեն կարող վերականգնվել ցանկացած բուժումից, որը մենք տալիս ենք նրանց,
05: 37.1, այնպես որ մենք կարող ենք նրանց վերաբերվել տրիպսինով,
05: 40.1 որը պրոտեոլիզացնելու է բոլոր սպիտակուցները,
05: 43.2 և մենք կարող էինք տեսնել ՝ դա սպիտակուց է, թե ոչ:
05: 45.2 Այսպիսով, երբ մենք դա արեցինք,
05:47.1 մենք նրանց բուժել ենք այս ֆերմենտներով,
05: 48.2, և մենք դեռ կպիտակավորենք դրանք և կօգտագործենք նույն անալիզը,
05:51.2 և այն, ինչ մենք գտանք, դա էր
05:54.1 տրիփսինով բուժումը ոչ մի ազդեցություն չի ունեցել
05: 57.3 բջիջների այս բիթերի այս ունակության վերաբերյալ
06:00.1 այս ազդանշանը գործարկելու համար,
06:01.3 մինչդեռ երբ մենք բուժում էինք ֆոսֆոլիպազներով,
06:04.2 սա ոչնչացրեց այդ գործունեությունը:
06: 06.1 Այսպիսով, սա հուշեց, որ թերևս:
06: 08.3 պոտենցիալ, այս ազդանշանը լիպիդ էր
06:11.0 և ոչ սպիտակուց:
06:12.3 Այսպիսով, երբ մենք սկսեցինք նայել,
06: 15.2 մենք սկսեցինք մասնատել այս լիպիդային կոտորակները,
06: 18.0, բայց մենք նաև սկսեցինք փորձարկել թեկնածուներին,
06: 21.0, և այն, ինչ մենք գտանք, դա ազդանշանն էր
06: 23.2-ը իսկապես լիպիդ էր, որը կոչվում էր սֆինգոսին 1-ֆոսֆատ,
06: 27.1 և այն եղանակը, որը մենք փորձարկեցինք
06: 30.2, եթե մենք կարողանայինք արգելափակել սֆինգոսին 1-ֆոսֆատի արտադրությունը
06: 32.2 այս [սֆինգոսին -կինազի արգելակիչով] -
06:34.3 այսպես, սֆինգոզին կինազ
06:37.0-ը կհանգեցնի սֆինգոզինի ֆոսֆորիլացմանը
06:38.3 և վերածվել սֆինգոզին 1-ֆոսֆատի --
06: 41.0, և երբ դա արեցինք, մենք արգելափակեցինք այս արձագանքը:
06:43.2 Այստեղ դուք կարող եք տեսնել, որ այս ցուցանիշը
06:46.0-ը շատ իջնում ​​է:
06: 47.2 Այսպիսով, սա իսկապես հուշում էր դա
06:50.0 այս ակտիվությունը սֆինգոզին 1-ֆոսֆատով:
06:53.0, որպեսզի փորձարկենք դա in situ, մեր էքստրուզիայի փորձարկման մեջ,
06:55.0 մենք նաև մշակել ենք արտամղիչ բջիջները
06: 58.1 սֆինգոսին -կինազի այս արգելակիչով:
07: 00.0 Եվ երբ մենք դա արեցինք, այն, ինչ դուք կարող եք տեսնել, դա է
07: 03.0 այս մահացող բջիջները չեն:
07: 05.0 -ին այլևս ի վիճակի չէին էքստրուզիա անել
07: 07.1 և փոխարենը դրանք անցքեր են ստեղծում այն ​​վայրերում, որտեղ բջիջները մահանում են,
07: 09.2 համեմատ հսկողության բուժման հետ
07: 12.1 որտեղ այդ բջիջները կարող են դուրս գալ շերտից
07:14.1, և այդ բացը փակվում է:
07: 17.2 Այսպիսով, այժմ մենք գիտենք, որ այս ազդանշանը
07: 21.1-ը լիպիդ է, որը կոչվում է սֆինգոսին 1-ֆոսֆատ (S1P):
07:23.1 Հայտնի էր, որ հինգ տարբեր ընկալիչներ կան
07: 25.2, որ սֆինգոսին 1-ֆոսֆատը կարող է կապվել,
07:29.1 և սրանք բոլորը G սպիտակուցով զուգակցված ընկալիչներ են,
07: 31.3, և մենք գնացինք, ապա,
07:33.2 փորձարկելով այս տարբեր թեկնածուներին տեսնելու համար
07: 35.2 Ո՞ր ընկալիչի համար դրանք կարող են պարտադիր լինել
07: 38.2 ՝ արտամղումը ակտիվացնելու համար:
07:41.0 Երբ մենք դա արեցինք, այն, ինչ մենք գտանք, դա էր
07: 43.1 արտամղման համար անհրաժեշտ է սֆինգոսին 1-ֆոսֆատ 2 ընկալիչ:
07: 46.3 Եթե դուք օգտագործում եք հակառակորդներ մյուս բոլոր ընկալիչների նկատմամբ
07: 50.1 -1, 3, 4 և 5 -
07:53.2 սա չի արգելափակում էքստրուզիան, ինչպես կառավարումը,
07: 57.1, սակայն, [sphingosine 1-phosphate receptor 2]-ի հակառակորդները
08: 00.2 կամ սֆինգոսին 1-ֆոսֆատ ընկալիչ 2-ի թուլացում shRNA- ի կողմից
08: 03.2 արգելափակել այս արտամղումը:
08: 07.2 Ավելին, մենք կարող ենք գտնել սֆինգոսին 1-ֆոսֆատի ներկման միջոցով,
08: 11.1 մենք կարող էինք տեսնել, որ սֆինգոսին 1-ֆոսֆատը ձևավորում է punctae
08: 15.1 շատ վաղ բջիջում, որը պատրաստվում է դուրս գալ:
08:19.0 Դուք կարող եք տեսնել սա կանաչ գույնով, այստեղ, որ այս բջիջները ձևավորում են կետային կետեր
08: 21.2, որոնք ձևավորվում են ինտերֆեյսի շուրջ
08: 25.1 արտամղման և կենդանի բջիջների միջև:
08: 27.2 Եվ հետաքրքիր է, որ այդ կետադրական կետերը ստանում են այն ժամանակ
08: 31.1 վերցված շրջակա բջիջներում, երբ բջիջները դուրս են գալիս,
08: 33.1 այնպես որ սա շատ ավելի ուշ փուլ է
08:35.2, և դուք կարող եք տեսնել, որ կետերն են
08: 37.3 շրջակա խցերում:
08: 39.1 Մենք գիտենք, որ այս հակամարմինը կարող է
08: 42.2 նույնականացնել սֆինգոսին 1-ֆոսֆատը
08:44.2 որովհետև հիմա չկա,
08:46.2, եթե մենք արգելակենք սֆինգոզին 1-ֆոսֆատի արտադրությունը
08:48.2 այս սֆինգոզին կինազային արգելակիչով:
08: 51.0 Եվ եթե մենք օգտագործում ենք հակառակորդին,
08:53.3 [սֆինգոզին 1-ֆոսֆատ ընկալիչ 2] անտագոնիստը,
08:56.1 սֆինգոզին 1-ֆոսֆատը մնում է այս բջիջում
08:58.2 և մի տեսակ կուտակումներ այստեղ:
09: 00.2 Այսպիսով, այն իրոք կարիք ունի սֆինգոսին 1-ֆոսֆատ ընկալիչ 2
09: 04.2 վերցնել սֆինգոսին 1-ֆոսֆատը
09:07.1 շրջակա խցերում.
09: 08.2 Այսպիսով, միասին վերցրած, մենք ունենք այս մոդելը
09:11.0, թե ինչպես է սֆինգոզին 1-ֆոսֆատը
09: 12.3 -ն կարող է վերահսկել ապոպտոտիկ բջիջների արտամղումը.
09: 16.1 երբ բջիջները ենթարկվում են ապոպտոզի,
09: 18.1 նրանք միաժամանակ արտադրում են լիպիդ,
09:20.2 սֆինգոզին 1-ֆոսֆատ,
09: 22.0, որն այնուհետև արտանետվում է շրջակա բջիջներին
09: 24.1 և կապվում է G սպիտակուցի հետ կապված ընկալիչի հետ,
09: 27.2 սֆինգոսին 1-ֆոսֆատ ընկալիչ 2,
09: 29.2 և սա շարունակվում է ՝ ակտիվացնելու համար Rho- ն
09: 31.3, և մենք նույնպես մտածում ենք Rac, այժմ,
09:33.2 այս ակտինի և միոզինի օղակը արտադրելու համար
09: 36.2, որը կծկվի, որպեսզի այն սեղմվի շուրջը և ներքևում
09:39.1 եւ քամել այն միաշերտից։
09:43.0 Այսպիսով, բջիջներն այսպես են արտամղվում
09: 45.2, երբ նրանց դրդում են մահանալ,
09:47.2, բայց մենք հաջորդիվ ուզում էինք հասկանալ
09:49.2 ինչպես են բջիջները բնականաբար ենթարկվում բջիջների մահվան
09:52.1 էպիթելիում,
09: 53.2 Ինչպես կարող է սա նույնպես համապատասխանել բջիջների թվին
09: 57.2 որոնք բաժանվում են այնպես, որ մենք կարողանանք բջիջների մշտական ​​թվեր պահպանել
10:00.0 իսկ էպիթելիան նորմալ է՞ գործում:
10:02.2 Եվ այսպես, այս խնդրին նայելու համար,
10: 04.2 այն, ինչ մենք արեցինք, այն էր, որ մենք նայեցինք բազմաթիվ տարբեր տեսակի էպիթելների,
10: 08.2 և սա պարզապես ցույց է տալիս մարդու հաստ աղիքի հյուսվածքի էպիթելիա,
10: 12.1, բայց ամեն տեսակի էպիթելիա, որին մենք նայում էինք,
10: 14.0 մենք տեսանք նույն տեսակի արդյունքներ:
10: 17.0 Այսպիսով, եթե դուք բիծ եք ունենում ապոպտոտիկ բջիջների համար
10: 21.3 ակտիվ caspase-3 ցուցիչով, կանաչ գույնով,
10: 24.2 Այն, ինչ տեսնում եք, այն վայրերն են, որտեղ բջիջները մահանում են
10:27.2 նրանք նույնպես արտահոսում են:
10:28.3 Սա այնքան էլ զարմանալի չէր,
10:30.3 քանի որ սա այն է, ինչ մենք գտել ենք բոլոր դեպքերում էպիթելիայում,
10: 34.0 -ն այն է, երբ բջիջները մահանում են, նրանք դուրս են պրծնում:
10:37.3 Բայց դեպքերում.
10:39.3 ժամանակի մեծ մասը:
10: 41.1 հիմա, հիշեք, որ այս էպիթելիան չի բուժվել որևէ ապոպտոտիկ խթանիչով,
10:45.0, ուստի այն, ինչ մենք գտնում էինք շատ ժամանակ, դա է
10:47.2 բջիջները արտահոսում են, քանի դեռ կենդանի են
10:49.3 -- Դուք կարող եք տեսնել, որ դրանք կասպազային բացասական բջիջներ են,
10: 52.2, բայց նրանք դեռ դուրս են պրծնում էպիթելիայից:
10: 56.0 Եվ այսպես, թվում է, թե այս բջիջները
10: 58.1 -ը իրականում բջջային ինքնասպանության չեն ենթարկվում
11: 01.1, բայց նրանք դուրս են մղվում հարևանների կողմից:
11: 04.1 Այսպիսով, երբ այս բջիջները դուրս գան արտամղման միջոցով,
11: 08.2 նրանք իսկապես ապրելու ոչինչ չունեն,
11: 10.3 և նրանք մահանում են անոիկիս կոչվող գործընթացով,
11:13.1 կամ մահ՝ գոյատևման ազդանշանի կորստի պատճառով:
11: 15.3 Այժմ, գոյատևման ազդանշան
11: 18.1 իսկապես կարևոր է էպիթելային բջիջների համար
11:19.3 և դա բխում է ստորև բերված մատրիցից,
11: 22.1 որտեղ բջիջները ամրացված են,
11:25.2 և հարևան բջիջները,
11: 27.1 և այսպես, երբ նրանք կորցնում են կապը դրա հետ,
11:29.1 այնուհետև նրանք կմեռնեն միայն գոյատևման ազդանշանի կորստի պատճառով:
11: 32.2 Այսպիսով, սա իսկապես մեզ հուշեց, որ
11: 36.1 էպիթելային բջիջներն իրոք մահանում են էքստրուզիայից առաջ.
11: 41.1 Սա մեզ ստիպեց այդ ժամանակ մտածել, թե ինչ կարող է հանգեցնել բջիջների արտամղման,
11:45.0, և մենք սրանից հուշումներ ստացանք
11: 47.2 դիտելով այն վայրերը, որտեղ մենք տեսանք բջիջների արտահոսք,
11: 49.2, և այն, ինչ մենք գտանք, այն է, որ դրանք միշտ դուրս էին մղվում
11: 52.1 պահպանվող գոտիներում,
11:54.0, և այդ գոտիները միշտ 1,6 անգամ ավելի մարդաշատ են եղել
11: 57.2 քան այն վայրերը, որտեղ նրանք չէին արտածվում:
12: 00.1 Եվ կային ոլորված գոտիներ,
12: 02.2, և դա կարող է ազդեցություն ունենալ
12: 05.1 բջիջի արտամղման ունակության մասին,
12: 07.0, բայց նույնիսկ հարթ միաշերտերի դեպքում
12: 08.3 -ին մենք պարզեցինք, որ այն վայրերը, որտեղ նրանք ամենայն հավանականությամբ դուրս կգան
12:12.0-ը միշտ 1.6 անգամ ավելի մարդաշատ էր:
12: 14.2 Այսպիսով, սա մեր դիտարկումն էր,
12: 16.1, բայց մեզ փորձելու միջոց էր պետք
12: 18.1 արդյոք դա իրականում ճիշտ էր,
12: 19.2 արդյո՞ք կուտակումները կարող են հանգեցնել բջիջների արտահոսքի:
12: 21.2 Եվ այսպես, դա անել,
12:24.1 մենք ստեղծեցինք ձգվող սարք, որն օգտագործեցինք հակառակ ուղղությամբ:
12: 26.1 Այսպիսով, սա ձգվող ափսե է, այստեղ,
12: 28.3, և երբ բջիջները աճում եք ձգված վիճակում
12: 31.2 և նրանց աճեցրեք միախառնման և ազատ արձակելու համար,
12:34.3 այնուհետև նրանք բազմամարդ կլինեն, ինչպես տեսնում եք այստեղ:
12:37.3 Եվ սա այն է, ինչ մենք իրականում տեսնում ենք այս էպիթելային բջիջներում:
12:43.1 30 րոպե, դուք կարող եք տեսնել, որ նրանք իրականում դառնում են բավականին մարդաշատ,
12: 46.0, բայց այն, ինչ կնկատեք, այն է, որ 6 ժամվա ընթացքում
12:48.1 նրանք վերադառնում են այս հոմեոստատիկ խտություններին
12:50.0, որ նրանք նախընտրում են.
12:51.3 Այսպիսով, կարծես այս բջիջները
12: 54.1 ունեն անձնական տարածքի զգացում:
12: 56.0 Գիտեք, դրանք չափազանց մարդաշատ են նրանց համար
12:58.0, և այստեղ նրանք ավելի հարմարավետ են զգում:
13: 01.1 Եվ սա ինձ իրականում հիշեցրեց մարդկանց մասին,
13:03.1, քանի որ մենք բոլորս զգում ենք անձնական տարածության զգացում
13: 05.2 և մենք կարող ենք ասել:
13: 08.2, երբ դառնում եք մեր անձնականից մոտ մեկ մատնաչափ
13: 10.2 մենք մեզ անհարմար ենք զգում,
13:12.1 և մենք անում ենք այն, ինչ պետք է անենք, որպեսզի վերադառնանք
13: 14.2 խտություն, որը մենք նախընտրում ենք:
13: 16.0 Եվ այսպես, սա ցույց տալու համար,
13: 18.0 Ես մտածեցի, որ կօգտագործեմ մարդուն
13: 19.3, և այդ մարդը Բլեյքն է, իմ դստեր ընկերը,
13: 23.2, որը նաև հայտնի է որպես Scrappy Bradford:
13:26.1 Այսպիսով, նա գտնվում է այնպիսի խտության վրա, որը նա նախընտրում է իր ընկերների հետ
13: 29.3 -իմ աղջկա Նադիան և Պոլին -
13:32.2 բայց ինչ կլինի, եթե Բլեյքը մտնի
13: 35.3 մարդկանց շատ ավելի մեծ խտությո՞ւն:
13:37.2 Իսկ եթե նա գնա խնջույքի Հելոուինի այս հագուստը հագնելուց հետո:
13:41.1 Իսկ եթե նա գնա համերգի:
13:45.1 Այսպիսով, սա անվճար համերգ է այգում։
13: 48.0 Այժմ, Բլեյքն իսկապես գտնվում է մի տարածքում, որտեղ նա չափազանց մարդաշատ է դառնում
13: 51.0, և ինչ տեղի է ունենում, նա դուրս է մղվում միաշերտից,
13:54.2, և դա հենց այն է, ինչ տեղի է ունենում մեր էպիթելային բջիջների հետ:
13:57.2 Այսպիսով, այն, ինչ մենք կարող ենք տեսնել, դա է
14: 00.1 մոտ 2 ժամ մարդաշատությունից հետո,
14: 02.1 այդ բջիջները դուրս են մղվում և,
14: 04.2 ինչպես նախկինում տեսանք հոմեոստազի ժամանակ,
14: 06.1 Այս բջիջների մեծ մասը կենդանի է, մինչդեռ դրանք դուրս են մղվում:
14: 09.1 Այժմ, այն, ինչ կնկատեք, այն է, որ 6 ժամվա ընթացքում
14: 11.2 դրանք վերադառնում են արտամղման հոմեոստատիկ արագություններին,
14: 13.2 ինչպես տեսանելի է հսկողության մեջ,
14:16.1 այն կետում, որտեղ նրանք իսկապես հետ են գնում
14:18.2 դեպի հոմեոստատիկ խտություններ:
14:20.1 Այսպիսով, իսկապես թվում է, որ այս բջիջները,
14: 21.2 երբ նրանք չափազանց մարդաշատ են դառնում,
14:23.0 հետ վերադառնալու համար օգտագործում են էքստրուզիա
14:26.1 այն թվերին, որոնք նրանք նախընտրում են:
14: 28.0 Այսպիսով, մենք նույնպես փորձեցինք
14:30.1 կարողացել է բացահայտել, որ նույն սֆինգոզին 1-ֆոսֆատ.
14:33.0 սֆինգոզին 1-ֆոսֆատ ընկալիչ 2/Rho ուղի
14:35.2, որը վերահսկում է ապոպտոտիկ բջիջների արտամղումը
14: 37.1 -ը նաև վերահսկում է կենդանի բջիջների արտահոսքը:
14: 39.3 Այս անալիզը մեզ թույլ տվեց նաև
14: 42.1 հետաքննել, թե արդյոք այդ բջիջները, երբ դուրս են մղվում,
14: 44.3 իրականում ողջ ենք, կամ մենք պարզապես
14: 47.0 չեն կարողանում բացահայտել ապոպտոտիկ մարկերները:
14: 49.1 Եվ այսպես, մենք վերցրեցինք բջիջները, որոնք դուրս էին մղվել միջավայրի մեջ
14: 53.1 և դրանք փոխարինեց տեսնելու համար
14:56.2 կարող էին աճել, թե ոչ,
14: 57.3, և այն, ինչ մենք գտանք, դա է
15: 00.2 -ին նրանք կարողացան ագռավվել ամբողջովին նոր միաշերտ
15:02.3, որը կարող է ինքնուրույն բաժանվել և դուրս մղվել:
15: 05.2 Նմանապես, երբ մենք խցեր վերցրինք
15:08.2 հոմեոստատիկ աճեցված միաշերտներից,
15: 11.1 նրանք կարող էին նույնը անել:
15:13.1 Ի տարբերություն, երբ մենք գործարկեցինք բջիջները
15: 16.0 ՝ դուրս մղվելու և մահանալու համար, նրանք կգնային:
15: 18.2 նրանք չէին կարող դա անել, և նրանք պարզապես կմահանային
15: 20.1 և նստեք ափսեի մեջ:
15:21.3 Այսպիսով, տան դասն այստեղ սա է
15: 24.3 բջիջները դուրս են մղվում, քանի դեռ նրանք կենդանի են,
15: 26.2 բայց, սովորաբար, քանի որ նրանք ապրելու ոչինչ չունեն,
15: 28.2 նրանք կշարունակեն մահանալ,
15:30.0, բայց նրանք լիովին ողջ են
15: 32.0, և եթե նրանք ունենան նոր ենթաշերտ, կարող են շարունակել ապրել:
15: 34.3 Այսպիսով, սա մեզ տարակուսեց
15: 38.0 արդյոք կարո՞ղ է զուգահեռ ճանապարհ լինել
15: 40.1, որը կարող է վերահսկել կենդանի բջիջների արտահոսքը:
15: 42.3 Նախկինում մենք դա նույնացրել էինք
15: 45.2 մահվան ազդանշանը կարող է ակտիվացնել ապոպտոզը
15:48.2 և բջիջների արտամղումը միաժամանակ,
15: 49.3, և եթե փակեք մահվան ուղին
15: 52.1 միաժամանակ այն գործարկելուն պես,
15: 54.1 դուք կխոչընդոտեիք, որ դրանք երկուսն էլ տեղի չունենան:
15: 56.3 Այնուամենայնիվ, այն դեպքում, երբ այդ բջիջները կենդանի են,
15: 59.2 դա այնքան էլ իմաստ չուներ
16:01.1, որ մենք անցնելու ենք մահվան ճանապարհով,
16: 03.1 և այսպես, մենք փնտրեցինք թեկնածուի ազդանշաններ
16: 07.0, որը կարող է վերահսկել կենդանի բջիջների արտահոսքը:
16: 09.0 Եվ այսպես, մենք գնացինք փնտրելով ձգվող և սթրեսային ուղիներ,
16:12.0 և այն, ինչ մենք բացահայտեցինք, դա էր
16:15.1 նույն ձգվող ալիքը
16:17.0 մենք հայտնաբերել էինք ձգվող միտոզ,
16: 19.3 և դա ձգվող ակտիվացված Piezo1 ալիքն է:
16:23.2 Եվ, որպես հիշեցում, սա է
16:27.1 ալիք, որը նստում է թաղանթների մեջ
16:30.1 և չափում է թաղանթների շեղումները
16: 32.0 ՝ կալցիումի ներհոսքը ակտիվացնելու համար:
16: 34.2 Եվ երբ մենք արգելափակում ենք Պիեզոյին, մենք գտնում ենք, որ հիմա,
16:38.3 մարդաշատությունից հետո,
16: 40.2 այս բջիջներն այլևս ի վիճակի չեն արտածվել,
16:42.2 և եթե հաշվեք նրանց, կտեսնեք, որ նրանք մնում են մարդաշատ և ոչ:
16: 45.3, նրանք մնում են այսպես խրված:
16: 48.0 Այսպիսով, իրոք, երկու առանձին ուղիներ կան
16: 50.2 արտամղման համար.
16:52.1 ապոպտոտիկ բջջային ուղի
16: 54.0 և կենդանի բջիջների ուղի:
16: 55.2 Եվ շատ կարևոր է իմանալ, որ երկուսն էլ գոյություն ունեն,
16: 59.1, երբ բջիջները մահանում են
17: 01.2 նրանք բջիջների մահվան հետ միաժամանակ ենթարկվելու են էքստրուզիայի
17: 04.2 - սա կարևոր է իմանալ,
17:07.0 հատկապես, եթե դուք պաթոգեններ եք ստանում կամ քիմիաթերապիա եք անցնում,
17: 09.1, որ այդ բջիջները դուրս են մղվում
17:11.2 այնպես, որ երբեք բացեր չառաջանան
17:14.0, երբ բջիջները մահանում են --
17: 15.2, բայց մենք կարծում ենք, որ մեծ մասամբ,
17:17.2 Ձեր բջիջները շատ ժամանակ իրականում բջիջների մահ են ապրում
17:20.3 այս մարդաշատ ճանապարհով,
17:23.0, որն անցնում է Piezo1-ով և ակտիվացնում է կալցիումը փորձելու համար:
17: 27.1 ՝ բջիջները դուրս մղելու համար
17: 30.1 և ապա նրանք մահանում են այս արտամղումից:
17:33.2 Այսպիսով, մինչ այժմ մենք միայն ցույց ենք տվել ձեզ
17:38.1 ինչ է կատարվում բջիջների կուլտուրայում,
17: 40.1 և ամեն անգամ, երբ մենք գտնում ենք դրանք նորերը
17: 43.1 հատկություններ, թե ինչպես են էպիթելային բջիջներն իրենց պահում,
17: 45.2 մենք ցանկանում էինք ստուգել, ​​արդյոք դրանք իրականում ճիշտ են in vivo- ում:
17: 48.3 Եվ այսպես, այն, ինչ մենք արեցինք, մենք վերադարձանք մեր զեբրա ձկների էպիդերմիսի մոդելին
17: 52.3 ՝ ստուգելու համար, թե արդյոք Պիեզոյին անհրաժեշտ էր
17: 56.0 այդ կայուն բջիջների քանակը արտամղման միջոցով պահպանելու համար:
17: 59.1 Եվ այսպես, երբ մենք արգելափակեցինք Պիեզոյին
18:01.3՝ տապալելով այն մորֆոլինոսների միջով,
18:04.1 մենք պարզեցինք, որ բջիջներն այլևս չեն արտամղվի
18:07.2 և նրանք կկազմեն այս մեծ զանգվածները
18: 11.2 այն վայրերում, որտեղ նրանք պետք է արտամղված լինեին:
18:13.2 Սա ավելի լավ կարող եք տեսնել այս ֆիլմում, այստեղ.
18: 15.3 Այսպիսով, սովորաբար, վայրի տիպի իրավիճակում,
18: 18.1 նրանք կարող են պահպանել հաստատուն թվեր, այստեղ,
18:21.1 դուք կարող եք տեսնել այս ԴՆԹ-ի ներկման միջոցով,
18: 23.1 և նրանք դա անում են մինչև:
18: 25.2 այդ բջիջները ավելի սերտորեն կբաժանվեն, թե որտեղ
18: 29.2 notochord- ն է, այնուհետև հեռանում
18: 31.3 և դուրս պրծնել:
18:33.2 Նույնը տեղի է ունենում Պիեզո մորֆանտում,
18: 36.1 բայց այս բջիջները, ոչ թե դուրս մղվելու,
18: 38.1 պարզապես կուտակվում են այն վայրերում, որտեղ դրանք պետք է արտամղվեին:
18: 41.2 Այսպիսով, սա իսկապես հուշում է.
18:43.2, որ այս բոլոր տարբեր էպիթելներում, որոնք մենք նայեցինք,
18:47.0, որ Պիեզո միջնորդավորված բջիջների արտամղումը
18: 50.1 -ը կարևոր է բջիջների մշտական ​​թվերի պահպանման համար:
18: 53.1 Եվ մեզ թողնում է այս մոդելը
18: 55.1 այն մասին, թե ինչպես են էպիթելային բջիջները շրջվում:
18: 58.0 Այսպիսով, էպիթելային բջիջները բաժանվում են սահմանված վայրերում,
19: 02.3 այստեղ, ծածկոցներում,
19:04.0 և այլ կայքերում, որոնք ավելի ձգված են:
19: 05.2 Նրանք հեռանում են բաժանման այս վայրերից
19: 08.2, և երբ նրանք այդպես են անում, նրանք համագումարում են
19: 11.2 այս տարածքներում, այստեղ,
19: 13.2 և, երբ դրանք 1.6 անգամ ավելի մարդաշատ դառնան,
19: 16.0 նրանք կակտիվացնեն բջիջները ՝ արտածելու համար
19: 19.2 սենսացիայի միջոցով Piezo1 ալիքով:
19: 21.3 Այս բջիջները մեծ մասամբ կենդանի դուրս կգան,
19:25.1, բայց հետո մեռնում են, որովհետև նրանք ապրելու ոչինչ չունեն:
19:28.0 Այսպիսով, դուք կարող եք տեսնել, հիմա,
19: 30.3, թե ինչպես կարող են իսկապես վերահսկել այդ մեխանիկական լարվածությունները
19: 34.0 էպիթելիում բջիջների մշտական ​​թվեր:
19:36.2 Երբ բջիջները բաժանվում են,
19: 40.0 ամեն անգամ, երբ մեկ այլ բջիջ բաժանվում է,
19: 42.0 սա կառաջացնի մարդաշատություն, այստեղ ՝
19: 43.3, ինչը կհանգեցնի բջիջների արտամղմանը:
19:45.2 Այսպիսով, դուք կարող եք պատկերացնել, որ եթե բարձրացնեք բաժանման տոկոսադրույքը,
19:48.0, եթե դուք կրկնապատկել եք բաժանման տոկոսադրույքը,
19: 50.1 դա ավելի շատ լարվածություն կառաջացներ,
19:51.3, ինչը կհանգեցնի այս բջիջների ավելի արագ արտահոսքի:
19:54.2 Եթե արգելափակեք կուտակումը զգալու ունակությունը,
19:57.3 ինչպես տեսաք Պիեզո մորֆանտի հետ,
20: 00.0, այնուհետև բջիջները կուտակվում են տեղերում
20:02.2, որտեղ նրանք պետք է extruded.
20: 04.3 Այսպիսով, միասին գտածը դա է
20: 08.1 իսկապես մեխանիկական լարվածություն կա, որը վերահսկում է
20:10.1 և՛ բջջային բաժանում, և՛ բջջային մահ,
20: 13.0 և դա, եթե բջիջները չափազանց նոսրանան
20:15.2 նրանք կզգան ձգում իրենց թաղանթների վրա
20: 17.2 և սա կակտիվանա,
20: 20.1 Պիեզո 1-ի միջոցով, ինչպես նաև Յապի, Տազի և cat-կատենինի միջոցով,
20: 23.2 ՝ ավելի շատ բջիջներ բաժանելու համար ակտիվացնելու համար
20: 26.2, որպեսզի նրանք վերադառնան հաստատուն թվերի,
20: 28.1, և եթե դրանք չափազանց մարդաշատ լինեն,
20: 30.1 -ը նրանք կակտիվացնեն բջիջը ՝ արտածելու համար
20: 32.1 ՝ նույնպես վերադառնալու այս հաստատուն թվերին:
20:35.1 Հիմա, մի բան, որ զարմանալի է մեզ համար
20: 39.1 երբ մենք գտանք այս երկու բաները, դա այն էր
20:42.1 Պիեզոն վերահսկում է այս երկու գործընթացները,
20: 45.0, այնպես որ հակառակ գործընթացները վերահսկվում են
20:47.2 ուղիղ մեկ ազդանշանով.
20: 50.3 Եվ սրա մյուս հետաքրքիր կողմը
20: 52.2 -ը կուտակումների հարաբերակցությունն էր
20: 55.1 -ը նույնպես նման էր ձգման հարաբերակցությանը,
20: 57.3, այնպես որ 1.6 անգամ ավելի շատ մարդաշատություն, մենք ստանում ենք բջիջների արտահոսք,
21: 01.0 որտեղ 1,6 անգամ ավելի ձգվում է, բջիջները բաժանվում են:
21: 04.3 Սա հետաքրքիր հարաբերակցություն էր
21:07.0, և մենք զարմացանք, թե ինչպես դա կարող է տեղի ունենալ, արդյոք.
21:11.0 քանի որ Piezo-ն իսկապես վերահսկում է կալցիումի ներհոսքը,
21:14.1 ինչպես կարող էր այն վերահսկել այս երկու հակադիր ռեակցիաները:
21: 18.2 Եվ այն, ինչ մենք գտանք, այն է, որ դրանք իրականում հատուկ են,
21: 21.1 այն լարվածության տեսակի համար, որը նրանք զգում են:
21:24.3 Այսպիսով, եթե խցերը կուտակվում են,
21:27.2 նրանք միայն էքստրուզիա կառաջացնեն,
21:29.2 նրանք չեն առաջացնի բջիջների բաժանում,
21: 31.3 և հակառակը, եթե նրանք ձգում են զգում,
21:34.1, ապա նրանք կհանգեցնեն բջիջների բաժանմանը, բայց ոչ բջիջների մահվան:
21: 37.3 Այսպիսով, ինչպե՞ս կարելի է զգալ այս երկու տարբեր լարվածությունները:
21: 41.2 Մենք դեռ իսկապես վստահ չենք,
21: 44.1, բայց մենք այժմ ուսումնասիրում ենք այս գործընթացը
21:47.3 և մենք ձեզ տեղյակ կպահենք,
21: 50.1, և որոշ ակնարկներ կարող են գալ
21:52.3, որտեղ Պիեզոն տեղայնացվում է տարբեր խտություններով:
21: 55.2 Այսպիսով, ենթահեղուկ բջիջներում,
21: 58.2 դրանք իսկապես գոյություն ունեն այս միջուկային ծրարի մեջ,
22: 01.3 մինչդեռ դրանք դառնում են:
22: 05.1 նրանք շփվում են միմյանց հետ,
22: 07.3 Պիեզոն այժմ սկսում է գնալ պլազմային թաղանթ,
22: 10.2 և դրանք ավելի տարածված տեղեր են,
22: 13.1, որտեղ նրանք ավելի հավանական է, որ ձգման փորձ ունենան
22: 16.3 և առաջացնել միտոզ:
22: 18.1 Դա կարող է ավելի հեշտությամբ պատահել այդ պլազմային մեմբրանի վրա,
22: 22.0 որտեղ այն կարող է զգալ ձգումը մեմբրանի վրա:
22: 25.2 Այժմ, երբ խցերը դառնում են ավելի մարդաշատ
22:28.3 և դեպի այն տարածքները, որտեղ ավելի հավանական է, որ դրանք արտամղվեն,
22:30.2 մենք տեսնում ենք, որ Պիեզոն զարգանում է այս մեծ ցիտոպլազմային զանգվածների մեջ
22: 35.0, և մենք իսկապես չենք կարող տեղայնացնել:
22: 37.1 մենք այնքան էլ վստահ չենք, թե ինչ են այդ զանգվածները,
22: 39.0, բայց մենք մտածում ենք, որ դրանք կարող են լինել հենց նրանք
22: 42.0, որը կարող է բախվել մարդաշատության
22: 44.3 ՝ կալցիումի փոխանցման համար, որը կհանգեցնի այդ բջիջների արտահոսքին:
22:47.1 Այսպիսով, ինչպես է դա տեղի ունենում, մենք դեռ շատ վստահ չենք,
22:50.1, բայց խնդրում եմ տեղեկացված մնացեք:
22:52.2 Կարծում ենք, որ դա պետք է հետաքրքիր արդյունք լինի:
22: 55.0 Այսպիսով, հաջորդ հատվածում,
22: 58.0 այն, ինչի մասին ես ձեզ կասեմ, այն է
23: 00.1 այժմ, երբ մենք իմացանք, որ այս տարբեր լարվածությունները
23: 02.1 կարող է վերահսկել բջիջների մշտական ​​թվերը,
23:04.2 դուք կարող եք ակնկալել, որ եթե խանգարեք այս գործընթացները,
23: 08.1, և մենք պարզապես կանդրադառնանք արտամղմանը,
23:10.1 Դուք կարող եք ստանալ տարբեր արատներ և տարբեր հիվանդություններ
23:14.2, որը կարող է առաջանալ ոչ բավարար բջիջներից,
23: 16.3, եթե բջիջների չափազանց մեծ արտահոսք լիներ
23: 18.2 կամ շատ բջջային մահ կամ աղքատ բջջային մահ,
23:20.2 և մենք կտեսնենք, որ խաթարում է էքստրուզիայի ողջ գործընթացը
23:24.3-ը կարող է հանգեցնել ոչ միայն ուռուցքի առաջացման,
23: 28.1, այլ նաև ուռուցքի առաջընթաց:
23: 30.3 Եվ ես կցանկանայի ավարտել ՝ շնորհակալություն հայտնելով իմ լաբորատորիայի մարդկանց
23: 33.1 ովքեր կատարել են այս աշխատանքը
23: 35.1 և նաև իմ ֆինանսավորման մարմինները:
23:36.3 Շնորհակալություն։


Աճի և չափի վերահսկում զարգացման ընթացքում

Օրգանների չափը և ձևը բնորոշ են յուրաքանչյուր տեսակի համար: Նույնիսկ երբ օրգանիզմները տարբեր չափերի են զարգանում՝ պայմանավորված շրջակա միջավայրի տարբեր պայմաններով, օրինակ՝ սնուցմամբ, օրգանների չափերը հետևում են մարմնի մնացած մասի հետ համաչափության տեսակների հատուկ կանոններին, մի երևույթ, որը կոչվում է ալոմետրիա: Հետևաբար, տվյալ միջավայրի համար օրգանները դադարում են աճը տեսակների գենոտիպով սահմանված կանխատեսելի չափերով: Ինչպե՞ս են օրգանները դադարեցնում աճը: Ինչպե՞ս կարող են հարակից տեսակները առաջացնել զարմանալիորեն տարբեր չափերի օրգաններ: Մինչ օրս վերջնական պատասխան չի տրվել: Աճի դադարեցման ուսումնասիրությունների հիմնական մոդելներից մեկը քացախի ճանճն է Դրոսոֆիլա մելանոգաստեր: Հետևաբար, այս վերանայումը հիմնականում կկենտրոնանա Հայաստանում իրականացված աշխատանքների վրա Դրոսոֆիլա փորձել տարանջատել հնարավոր մեխանիզմները և բացահայտել հետագա հետաքննության ուղիները. Կենդանիների աշխարհում հայտնաբերված ընդհանուր կանոններից մեկն այն է, որ աճի տեմպը նվազում է զարգացման ժամանակի հետ: Հետևաբար, աճի դադարեցման խնդրի պատասխանները պետք է բացատրեն այս թվացյալ համընդհանուր փաստը: Բացի այդ, աճի դադարեցումը սերտորեն կապված է օրգանների չափի ամրության (այսինքն ՝ ճշգրտության) և պլաստիկության, օրգանների սիմետրիկ և ասիմետրիկ զարգացման խնդիրների և այն բանի հետ, թե ինչպես է «նպատակային» չափը կախված արտաքին, շրջակա միջավայրի գործոններից:

1. Ներածություն

1.1. Ներքին և արտաքին աճի վերահսկում

Քսաներորդ դարի սկզբին Հարիսոնը [1] ներդրեց փոխպատվաստման փորձեր ՝ գնահատելու օրգանների ներքին (ինքնավար) և օրգան-արտաքին (ոչ ինքնավար) աճի վերահսկման հարաբերական ներդրումները: Հետերոպլաստիկորեն փոխպատվաստված օրգանների նախնական ուսումնասիրությունները ցույց տվեցին երկիմաստ արդյունքներ աճի օրգան-արտաքին և օրգան-ներքին հսկողության կարևորության վերաբերյալ [1–7]: Twitty & amp Schwind [8] -ը ներկայացրեց առավելագույն կերակրման ռազմավարություն, որը հանգեցրեց դոնորի, ստացողի և փոխպատվաստման աճի առավելագույն հնարավոր տեմպին: Այս կերպ Twitty & amp Schwind- ը կարողացան վերահսկվող և կարծրատիպային եղանակով առանձնացնել ներքին և արտաքին գործոնները (օրինակ ՝ սնունդը): Նրանք աչքերն ու վերջույթները պատվաստել են պոչի բուդի փուլում ՝ տարբեր չափի սալամանդրի երկու տեսակների միջև. Ambystoma punctatum (այժմ հայտնի է որպես Ambystoma maculatum կամ բծավոր սալամանդր) և A. tigrinum (կամ վագրային սալամանդր): Օգտագործված պոպուլյացիաներում ՝ A. tigrinum աճում է մոտավորապես 1,8 անգամ մեծ A. punctatum [1]: Նույն չափի հարաբերակցությունը նկատվում էր նաև ուսումնասիրված թրթուրների փուլերի դեպքում, չնայած որ սկզբում թրթուրները նույն չափի էին [8]: Երբ օրգանները պատվաստվել են այս երկու տեսակների սաղմերի միջև պոչի բողբոջների փուլում, Twitty & Schwind-ը պարզել է, որ պատվաստման աճը համեմատելի է վերահսկիչ օրգանի աճի հետ, որը մնացել է դոնորական սալամանդրի վրա: Այսպիսով, աչքերը կամ վերջույթները աճեցին համեմատելի կինետիկայով և մոտավորապես նույն չափով, ինչ կկատարեին, եթե դրանք չփոխպատվաստվեին (նկար 1) [8]: Այս հայտնագործությունն ավելի ապշեցուցիչ էր ՝ հաշվի առնելով, որ վերջույթներն առաջին անգամ հայտնվում են այս տեսակների զարգացման տարբեր ժամանակաշրջաններում, և որ դրանք ընդհանրապես մեծապես տարբերվում են իրենց աճի կինետիկայով: Նմանատիպ հայտնագործություն է գրանցվել նաև փոխպատվաստման փորձերի դեպքում A. punctatum և աքսոլոտլը [8], և հավի սաղմերի միջև թևերի բողկների հետերոխրոնիկ փոխպատվաստումների ժամանակ [9,10] ՝ նշելով դրա ընդհանուր վավերականությունը:

Նկար 1. Օրգանների չափի ներքին հսկողություն: Պատվաստման փորձերը ցույց են տալիս աճի ներքին վերահսկողություն: վերջույթները փոխպատվաստվել են սաղմերի միջև A. punctatum եւ A. tigrinum. Պատվաստված վերջույթները (գր.) Աճում են համադրելի կինետիկայի և նույն չափի հետ, ինչ նրանց չպատվաստված հսկիչները: Նկարում պատկերված են կենդանիներ վիրահատությունից 40 օր անց: Վերարտադրվել է Twitty & amp Schwind- ի թույլտվությամբ [8] (հեղինակային իրավունք © 1931 John Wiley and Sons):

Հետաքրքրաշարժ է, որ օրգանները օգտագործում են տարբեր մեխանիզմներ իրենց չափերը ճշգրտելու համար, և օրգան-ներքին և օրգան-արտաքին գործոնների հարաբերական ներդրումը կարող է տարբեր լինել `կախված հետաքրքրող օրգանից, նույնիսկ մեկ տեսակի մեջ: Այսպիսով, Metcalf-ը [11,12] պարզեց, որ զարգացող մկան մեջ փոխպատվաստված բազմաթիվ պտղի տիմուսային գեղձեր, որոնցից յուրաքանչյուրը աճում է մինչև իրենց նորմալ չափը, մինչդեռ բազմաթիվ պտղի փայծաղներն աճում են մինչև մեկ չափահաս փայծաղի զանգված: Յուրաքանչյուր փայծաղ ինքնին մնում է ավելի փոքր այնպես, որ ընդհանուր զանգվածը համարժեք է մեկ նորմալ փայծաղի: Այս փորձերը ենթադրում են, որ թիմուս գեղձերի աճը կարգավորվում է օրգան-ինքնավար կամ օրգան-ներքին գործոններով, մինչդեռ փայծաղի աճը, կարծես, վերահսկվում է բացասական արձագանքման մեխանիզմով, որը վերահսկում է զարգացող օրգանի արտաքին միջավայրը (այսինքն ՝ օրգան- արտաքին գործոններ):

Այն, որ մի քանի փոքր փայծաղները կարող են լրացնել մեկ նորմալ չափի փայծաղ, հուշում է, որ փոքր փայծաղները զարգացնում են նույն գործառույթը, սակայն ավելի փոքր զարգացման տիրույթում: Զարգացման գործընթացներն իսկապես հաճախ մասշտաբվում են զարգացման տիրույթների և ժամանակային մասշտաբների փոփոխություններով: Օրինակները ներառում են ինսուլինի հետ կապված գեների մուտացիաները, որոնք հանգեցնում են էականորեն ավելի փոքր (երկակի), բայց կատարյալ համամասնությամբ ճանճերի [13], ինչպես նաև գորտի սաղմերի մանիպուլյացիաներին, որոնք հանգեցնում են ավելի փոքր, բայց կատարյալ նախշերով շերեփուկների [14]:

Ամփոփելով, օրգանների աճը վերահսկվում է ինչպես օրգան-ներքին, այնպես էլ օրգան-արտաքին մեխանիզմներով, և վերահսկման մեխանիզմների հարաբերական ներդրումը տարբերվում է օրգանների միջև: Այս վերանայում մենք կենտրոնանալու ենք օրգանների աճի դադարեցումն ապահովող ներքին մեխանիզմների վրա: Ընթերցողները, ովքեր հետաքրքրված են օրգան-արտաքին մեխանիզմներով և օրինաչափությունների մասշտաբով, պետք է հղում կատարեն ոլորտի ակնարկներին և հիմնական հոդվածներին [15-24]:

1.2. Դրոսոֆիլա երևակայական սկավառակներ ՝ որպես մոդելային համակարգեր

Հաշվի առնելով աճի վերահսկման մեխանիզմների բարդությունը, զգալի պատկերացումներ են ձեռք բերվել պարզ մոդելային համակարգի ուսումնասիրությունից, Դրոսոֆիլա երևակայական սկավառակներ.

-ի կյանքի ցիկլը Դրոսոֆիլա բաղկացած է սաղմնածնությունից, որը տեղի է ունենում բեղմնավորված ձվաբջջում, երեք թրթուրային փուլեր, առաջինից երեք փուլեր (որոնք բաժանված են ցողուններով), ձագացումից, որի ընթացքում տեղի է ունենում մետամորֆոզ, և վերջապես, հասուն փուլը՝ որպես լիովին զարգացած ճանճ (նկ. 2):ա): Երևակայական սկավառակները հիմնականում աճում են թրթուրի փուլերում, քանի որ մեծահասակների թռչունների արտաքին մարմնի մեծ մասի առաջնային մասը, օրինակ ՝ թևերն ու աչքերը (նկար 2բ): Առաջին դարասկզբի սկզբում թևի սկավառակի նախնադարյան հատվածը բաղկացած է մոտ 30 բջիջից, սակայն ամբողջական սկավառակ կարող է ստեղծվել նույնիսկ չորսից վեց հիմնադիր բջիջներից [31]: Այնուհետև բջիջները սովորաբար ենթարկվում են բջիջների բաժանման 9-ից 11 փուլերի [31,32]: Բջջների քանակի աճին զուգահեռ սկավառակը նաև փոխում է իր տեսքը՝ «հարթեցված պարկից» վերածվելով շատ ավելի ճկված էպիթելիի, որի սկավառակը մի կողմում է, իսկ ծայրամասային թաղանթը հակառակ կողմում: Թեև սկավառակը պատշաճ կերպով բաղկացած է սյունաձև ձևի բջիջներից, իսկ ծայրամասային թաղանթը կազմված է շերտավոր բջիջներից: Սկավառակի մի հատվածը, այսպես կոչված, թևի քսակը, վերածվում է թևի բերանի և գրավում է հետազոտությունների մեծ մասը (նկար 2բ): Սկավառակի մյուս մասերը կազմում են կրունկը, թևի և մարմնի միջև կապը և կրծքավանդակի մասերը: Պոպուլյար փուլում տեղի է ունենում ևս մեկ բաժանման մոտավորապես երկու փուլ [33]: Մետամորֆոզում բջիջների թվի հաշվարկները տատանվում են 30 000 [32] - ից մինչև 50 000 բջիջ [34]: Թևը դուրս է գալիս շրջման միջոցով (այսինքն ՝ թրթուրի պատից ներսից դեպի դուրս ՝ ձագուկի դեպքում ազատ տարածություն) [35]: Քանի որ թևի բջիջները չեն բաժանվում կամ աճում շրջվելուց հետո [28], այս պահին թևի սկավառակի վերջնական չափը որոշում է հասուն թևի վերջնական չափը:

Նկար 2. The Դրոսոֆիլա թևի երևակայական սկավառակը որպես աճի վերահսկման մոդելային համակարգ: (ա) կյանքի ցիկլը Դրոսոֆիլա. Հասուն ճանճը պարարտացած ձվերը, որոնցում սաղմնավորում է տեղի ունենում, դնում է սննդի մեջ: Ձվադրումից (ԱԷԼ) մոտ 1 օր հետո սաղմնավորումն ավարտվում է, և թրթուրները դուրս են գալիս ձվերից: Թրթուրի փուլը տևում է ընդհանուր առմամբ մոտ 4 օր և ներառում է երկու մուլետ ՝ առաջինից երկրորդ փուլը մոտավորապես 48 ժամ AEL- ով և երկրորդից երրորդը մոտավորապես 72 ժամ AEL- ով [25,26]: Մինչև պուպուլացիայի ենթարկվելը, թրթուրները դադարում են սնվել (մոտ 5 օր AEL) և մտնում են թափառման փուլը, որտեղ չոր տեղ են փնտրում: Պուպուլացիայի ընթացքում փոխակերպում է տեղի ունենում, և մեծահասակների մարմնի կառուցվածքները հավաքվում են երևակայական սկավառակներից: (բ) Երրորդ աստղի մուլտֆիլմ Դրոսոֆիլա թևի սկավառակ: Թևի սայրը զարգանում է այսպես կոչված թևի քսակից (մուգ մոխրագույն): Սկավառակի մյուս մասերը կազմում են թևի և մարմնի (ծխնու) կամ կրծքավանդակի հատվածների միջև կապը: Doուցված են մեջքի -վենտրալ (DV, բաց կապույտ) և առջևի հետևի (AP, մուգ կանաչ) սահմանները, ինչպես նաև Dpp (բաց կանաչ) արտահայտչական գոտին: (գ) Արգելափակելով (i) կամ բարձրացնելով (iii) բջջային ցիկլը փոխում է բջիջների չափը, բայց ոչ թևի սկավառակի ընդհանուր չափը (ii- ում վայրի տեսակի սկավառակ): DE2F- ի սահմանային գերարտադրությունն ավելացրեց S- և M- փուլերի նախաձեռնող Cyclin E և String (Cdc25) արտահայտությունը, դրանով իսկ արագացնելով բջիջների տարածումը: Նկարները հարմարեցված են Նոյֆելդից et al. [27]: Վերատպվել է Elsevier-ի թույլտվությամբ։ (դ) Dpp ազդանշանային ուղու պարզեցված նկարազարդում: Mad-ը ֆոսֆորիլացվում է, երբ Dpp-ը միանում է իր Tkv ընկալիչին: Med- ի և Schnurri- ի (Shn) հետ միասին, Mad- ը կարգավորում է հոսանքն ի վար թիրախների արտահայտումը սալ եւ omb և խոչընդոտում է տառադարձման ճնշողի արտահայտմանը բրկ. Dpp ազդանշանի բացակայության դեպքում, բրկ արտահայտված է և Brk- ն արգելակում է արտահայտությունը սալ եւ omb. (ե) Dpp-ի և թիրախ գեների արտահայտման տիրույթների բաշխումը սալ, omb եւ բրկ մեջ Դրոսոֆիլա թևի սկավառակ: dpp արտահայտված է ԱՊ հատվածի սահմանից անմիջապես առաջ (բ) (S, աղբյուր) և ձևավորում է երկկողմանի գրադիենտ (կանաչ): Dpp- ն առաջացնում է սալ (բաց կապույտ) և omb (մուգ կապույտ) և նվազեցնում է բրկ (դ), սահմանափակելով դրա արտահայտությունը կողային կողմերին (կարմիր). -Ի արտահայտչական գոտին omb ավելի լայն է, քան մեկը սալ Dpp-ի նկատմամբ իրենց տարբեր զգայունության պատճառով: (զ) Աճի վերահսկում մորֆոգեններով. գրադիենտ թեքության մոդելը, ինչպես սկզբնապես առաջարկվել է Day & Lawrence-ի կողմից [28]: Այս մոդելի համաձայն, բջիջները զգում են (գծային) Dpp գրադիենտի թեքությունը և տարածվում են լանջին համաչափ: Timeամանակի առաջընթացով թեքությունը նվազում է, և համապատասխանաբար դանդաղում է բջիջների տարածումը (բացից մինչև մուգ կանաչ): (է) Մորֆոգենների կողմից աճի վերահսկում. Շվանկի առաջարկած աճի հավասարեցման մոդելը et al. [29]։ Այս մոդելի համաձայն, թևի սկավառակի քսակի աճը բնածինորեն միատարր է (բաց կապույտ): Dpp- ի բացակայության դեպքում կողային բջիջներն ունեն աճի առավելություն և ավելորդ տարածում (բաց կապույտ): Այս չափազանց տարածումը հանգեցնում է հյուսվածքի միջնամասում տարածված տարածման արգելման (գծիկ, բաց կապույտ): Dpp-ն հանգեցնում է աճի հավասարեցման, այնպես, որ արդյունքում աճի տեմպը միատարր է ամբողջ հյուսվածքում (մուգ կապույտ): Dpp-ն սահմանափակում է Brk-ի արտահայտումը հյուսվածքի կողային մասերում (կարմիր, ավելի հաստ գծերը ցույց են տալիս ավելի ուժեղ արգելակում): Brk- ն կանխում է ավելորդ տարածումը (վարդագույն), դրանով իսկ ազատելով պայուսակի միջնամասում տարածման արգելքը: (հ–ջ) Մորֆոգենների կողմից աճի վերահսկում. Ուորթլիքի առաջարկած ժամանակային դինամիկայի մոդելը et al. [30]։ Այս մոդելի համաձայն, բջիջները բաժանվում են ամեն անգամ, երբ զգում են Dpp ազդանշանային մակարդակների որոշակի հարաբերական աճ: (ժ) Dpp գրադիենտի ամպլիտուդը և երկարությունը երկուսն էլ ընդլայնվում են աճող թևի սկավառակի տիրույթում Լ(տ) զարգացման ընթացքում (բացից մինչև մուգ կանաչ): (եսԲոլոր գրադիենտ պրոֆիլները փլուզվում են մեկ կորի վրա, եթե նորմալացված են առավելագույն Dpp կոնցենտրացիայով (գառավելագույնը) և տիրույթի երկարությունը Լ(տ) (այսինքն ՝ գրադիենտների սանդղակ): (ժ) գծային աճող ամպլիտուդով էքսպոնենցիալ, մասշտաբային գրադիենտի համար կոնցենտրացիայի հարաբերական փոփոխությունը dգ/գ(տ) հավասար է ամբողջ տիրույթում և նվազում է զարգացման ժամանակի հետ (բացից մինչև մուգ կանաչ): Այսպիսով, աստիճանաբար ավելի երկար ժամանակ է պահանջվում բջիջների տարածումը խթանելու համար անհրաժեշտ հարաբերական աճին և աճի դադարեցմանը:

Կան մի քանի դիտարկումներ, որոնք ենթադրում են, որ նաև երևակայական սկավառակների վրա աճի վերահսկումը մեծապես հիմնված է օրգանների ներքին մեխանիզմների վրա [36]: Որոշ չափով համեմատելի վերջույթների փոխպատվաստման հետ, երևակայական թևի կամ աչքի սկավառակները աճում են իրենց նորմալ չափի, նույնիսկ եթե դրանք բոլորովին այլ արտաքին պայմաններում են: Այսպիսով, երբ երևակայական սկավառակները կտրվում էին զարգացող թրթուրներից և փոխպատվաստվում չափահաս ճանճերի որովայնին, դրանք զարգանում էին, նույնիսկ եթե զարգացման ավելի ցածր արագությամբ, նմանվում էին սովորական սկավառակների չափին և ձևին [34,37]: Աճը դադարեց անկախ հյուրընկալողի տարիքից, բայց բացառապես փոխպատվաստումների տարիքից և չափից ելնելով [37]: Նմանապես, չափահաս ճանճերի որովայնին փոխպատվաստված սկավառակների բեկորների աճող աճը կարող է հանգեցնել նորմալ չափի սկավառակների [38,39]:

Այսպիսով, ինչպե՞ս են երևակայական սկավառակները զգում իրենց չափը և համապատասխանաբար կարգավորում դրանց աճի տեմպը: Առաջարկվել են մի քանի մեխանիզմներ և մոդելներ, որոնք բացատրում են աճի դադարեցումը օրգանապես ներքին եղանակով: Այստեղ մենք տրամադրում ենք ակնարկ և քննարկում փորձարարական ապացույցները հօգուտ և դեմ նրանց՝ կենտրոնանալով հիմնականում հետազոտությունների արդյունքում ստացված ապացույցների վրա։ Դրոսոֆիլա սկավառակներ:

2. Աճի դադարեցումը վերահսկող մոդելներ

2.1. Աճի վերահսկում բջիջների բաժանման դեպքերի քանակի սահմանափակմամբ:

Բջիջների բաժանման իրադարձությունների հաշվումը կներկայացնի ինքնավար աճի դադարեցման պարզ մեխանիզմ: Անկախ զարգացման արագությունից, նման մեխանիզմը կհանգեցներ բջիջների նույն վերջնական թվին և, եթե բջիջները պահեն նույն չափը, թևի սկավառակի նույն վերջնական չափը: Մի քանի խումբ փորձարկեց այս հնարավորությունը ՝ շահարկելով բջջային ցիկլը և եզրակացրեցին, որ հյուսվածքների չափի վերահսկումը չի հասնում բջիջների բաժանման հաշվարկման միջոցով [27,40]: Այսպիսով, բջիջների բաժանման ամբողջական արգելափակումը ձագերի փուլում և որոշ չափով նույնիսկ թրթուրային փուլերում չի փոխել թևի սկավառակի վերջնական չափը [40]: Նմանապես, բջջային ցիկլի երկարության մանիպուլյացիան տրանսկրիպցիոն կարգավորիչի dE2F-ի կամ դրա կորպրեսորային RBF-ի կամ գերարտահայտման կամ արգելափակման միջոցով փոխեց բջիջների համարները չորսից հինգ անգամ, բայց չազդեց թևի վերջնական չափի վրա (նկ. 2):գ) [27]։ Հետաքրքիր է, որ մեկ խցիկում բջիջների չափի մանիպուլյացիաները դեռևս հանգեցրել են առջևի/հետևի խցիկի չափի ճիշտ վերջնական հարաբերակցությանը, ինչպես դատվում է տեսողական ստուգմամբ, այլ ոչ թե ճշգրիտ քանակական հաշվարկով [27]:

Պետք է նշել, որ այս եզրակացությունը կիրառվում է անողնաշար կենդանիներից դուրս: Այսպիսով, արևելյան տրիոնի բջիջները (Triturus viridescens) սովորաբար դիպլոիդ են (այսինքն՝ պարունակում են քրոմոսոմների երկու հոմոլոգ խմբեր) [41]: Քրոմոսոմների քանակի ավելացման կամ նվազման դեպքում (haploid = 1, triploid = 3, tetraploid = 4 կամ նույնիսկ մինչև pentaploid = 5), որը տեղի է ունենում բնական ճանապարհով, բայց կարող է նաև կիրառվել փորձարարական տեխնիկայի միջոցով, բջիջները մեծանում և նվազում են չափերով: համապատասխանաբար: Բջիջների չափի այս փոփոխությունը փոխհատուցվում է մարմնի և օրգանների մակարդակով `բջիջների քանակով, այնպես, որ սաղմերը մոտավորապես նույն չափի են [41-43]: Նմանատիպ բացահայտումներ են նկատվել նաև մկների մոտ [44]: Տարբեր օրգաններ, ըստ երևույթին, օգտագործում են տարբեր մեխանիզմներ նման չափի փոխհատուցման հասնելու համար: Այսպիսով, գեղձային օրգանների դեպքում չափը կամ փոխհատուցվում էր առանձին խողովակների ավելացմամբ ՝ դրանց թիվը մշտական ​​պահելով, կամ էլ մեծանում էր խողովակների քանակը ՝ պահպանելով դրանց չափերը [41]: Այս դիտարկումները ցույց են տալիս, որ տարբեր մեխանիզմներ, ըստ երևույթին, ապահովում են օրինաչափության ամրությունը չափի փոփոխության դեպքում, ինչպես նաև մի շարք մեխանիզմների առկայություն՝ չափերը շտկելու համար՝ փոխհատուցելով աճը:

2.2. Աճի դադարեցում `սահմանափակելով զարգացման ժամանակը:

Theարգացման ընդհանուր ժամանակի սահմանափակումը կկազմի մեկ այլ ուղղակի մեխանիզմ: Martín & amp Morata- ն շահագործեց ազդեցությունը Րոպե մուտացիա (որը նվազեցնում է սպիտակուցի սինթեզի արագությունը) ՝ ուսումնասիրելու լրացուցիչ զարգացման ժամանակի ազդեցությունը թևի վերջնական սկավառակի չափի վրա ՝ դանդաղ աճեցնելով Մ/+ նորմալ աճող րոպե + ունեցող թրթուրներ (M + ) թևերի սկավառակներ [45]: Համասեռամոլը Րոպե մուտացիան մահացու է Դրոսոֆիլա, բայց հետերոզիգոտ Րոպե մուտանտներ (Մ/+) զարգանում է, նույնիսկ եթե ավելի դանդաղ, քան վայրի տիպի հսկիչները՝ միտոտիկ արագության նվազման պատճառով [46,47]: Նրանք հաշվարկել են, որ այս համակարգն օգտագործելով ՝ սկավառակները տրամադրվում են 20 ժամ լրացուցիչ աճի ժամանակ: Բջջային ցիկլի միջին տևողությունը մոտավորապես 10 ժամ, դա կարող էր հանգեցնել բջիջների բաժանման լրացուցիչ երկու փուլերի կամ, ենթադրելով բջջի մշտական ​​չափը, սկավառակի չափի քառապատիկ աճ: Ինչ-որ չափով զարմանալի է, որ թևի սկավառակի չափերի զգալի տարբերություն չկար նախամորթական փուլում կամ մեծահասակների թևերի միջև, ինչը ցույց է տալիս աճի դադարեցման սկավառակի ներքին մեխանիզմը [45]: Չկար նաև որևէ «ավելորդ» բջիջների ապոպտոզ: Ստեղծելով խճանկարային սկավառակներ, որոնցում գտնվում էր կամ առջևի (A) կամ հետևի (P) խցիկը M + , նրանք կարող են նաև ցույց տալ, որ կուպեների չափերի սկզբնական տարբերությունը, աճի տարբեր տեմպերի պատճառով, անհետանում է մինչև զարգացման ավարտը ՝ ենթադրելով, որ աճի արգելակման մեխանիզմն ինքնուրույն է գործում A- և P- խցիկներում [45]: Եզրափակելով, սկավառակները դադարեցնում են իրենց աճը համապատասխան չափի հասնելուց հետո, նույնիսկ եթե ապահովված է զարգացման լրացուցիչ ժամանակով [45]:

Այս արդյունքները միասին վերցված աջակցում են սկավառակի ինքնավար մեխանիզմին, որը դադարեցնում է աճը վերջնական չափին հասնելուն պես: Աճը դադարեցնող այս մեխանիզմը չի գործում՝ հիմնված բջիջների հաշվման պարզ մեխանիզմի կամ զարգացման հասանելի ժամանակի վրա:

2.3. Արդյո՞ք աճի դադարեցումը վերահսկվում է մորֆոգեններով:

Մորֆոգենները հիմնականում ուսումնասիրվել են որպես ձևավորման կարգավորիչներ, սակայն ունեն լավ փաստագրված ազդեցություն նաև վերջնական օրգանի չափի վրա: BMP2- կոդավորող գենը decapentaplegic (dpp) ամենաշատ ուշադրությունը գրավել է որպես աճը վերահսկող մորֆոգեն, քանի որ այն արտահայտված է բոլոր 15 երևակայական սկավառակներում (այստեղից էլ նրա անվանումը Decapentaplegic) և էկտոպիկ արտահայտությունը. dpp կամ Thickveins (Tkv) ընկալիչի ակտիվացված ձևը հանգեցնում է գերաճի [48–53]: Ի հակադրություն, նրա ակտիվության նվազումը կտրուկ նվազեցնում է թևերի չափը, և ընկալիչի կամ ներքևի գեների համար մուտանտ բջիջների կլոնները չեն կարողանում աճել [48,54-59]:

Արտազատվում է թևի սկավառակի AP սահմանից անմիջապես առաջ գտնվող բջիջների շերտից (նկար 2բ), Dpp- ն ձևավորում է երկկողմանի գրադիենտ (նկար 2ե) [60–63]։ Dpp-ի միացումը Tkv-ին հանգեցնում է մայրերի տրանսկրիպցիոն գործոնի ֆոսֆորիլացմանը dpp-ի դեմ (Mad, pMad), որը կարգավորում է գենի արտահոսքը (նկար 2):դ) [64–68]: Այսպիսով, pMad- ը կազմում է բարդույթ Մեդեայի (Մեդ) հետ և դրդում արտահայտությունը սպալտ (սալ) և dpp-ի դուստրը (հայրիկ), և նվազեցնում է տառադարձող ճնշողի արտահայտությունը ծակող (բրկ) (նկար 2դ,ե) [50,51,68–73]: Brk-ը բացասաբար է կարգավորում արտահայտությունը օպտոմոտոր-կույր (omb), և pMad- ը նաև անուղղակիորեն դրական ազդեցություն ունի դրա վրա omb արտահայտություն (նկար 2դ,ե) [50].

Երկու հիմնական հարց կա, որոնց պետք է պատասխանել, երբ Dpp- ն դիտվում է որպես աճի/չափի կարգավորիչ. (ii) Ինչպե՞ս կարելի է բացատրել աճի դադարեցումը ճիշտ չափով: Մշակվել են մի քանի մոդելներ `երկու կամ երկու հարցերին պատասխանելու համար: Դրանք տարբերելու համար մոդելները կարելի է բաժանել «ուսանելի» և «թույլատրելի» մոդելների [74]: Ուսուցողական մոդելները վերագրում են աճի կարգավորման դերը Dpp-ին և, հետևաբար, միաժամանակ լուծում են երկու հարցերը: Մյուս կողմից, թույլատրելի մոդելները բացատրում են միայն այն, թե ինչպես Dpp-ն կարող է հանգեցնել աճի միատեսակ տեմպի [74], և այդպիսով կախված է աճի դադարեցման այլ մեխանիզմներից: Երկու տեսակի ամենակարևոր մոդելները քննարկվում են հետևյալ բաժիններում:

2.4. Շեմային մոդելը

Համաձայն շեմային մոդելի, բջիջները բաժանման համար պահանջում են Dpp-ի կոնցենտրացիան, որը բարձր է որոշակի շեմից: Սկավառակի ընդլայնման հետ մեկտեղ, սկավառակի կողային եզրերի բջիջները, ի վերջո, կիջնեն այս Dpp շեմից և կդադարեն բաժանումը: Ըստ շեմային մոդելի, սկավառակը դադարեցնում է աճը, երբ ամենակողային բջիջները դադարում են բաժանվել: Այսպիսով, շեմային մոդելը ենթադրում է երկուական ամեն ինչ կամ ոչինչ, պատասխան Dpp մակարդակներին: Սա, սակայն, անհամապատասխան է այն դիտարկմանը, որ կողային բջիջների կլոնների աճը հաստատունորեն ակտիվ Dpp- ով ավելի արագ է, քան վայրի տիպի կլոնները [58]. տարածվում են նույն արագությամբ, ինչ վայրի տիպի կլոնները:

2.5. Գրադիենտ լանջի մոդելը

Գրադիենտ թեքության մոդելը, որն ի սկզբանե առաջարկվել է Day & Lawrence-ի կողմից [28], նշում է, որ բջիջները զգում են Dpp գրադիենտի թեքությունը։ Մոդելի կատարելագործման մեջ առաջարկվեց, որ միայն միջնակարգ բջիջները պահանջում են լանջի զգացում, մինչդեռ կողային բջիջները արձագանքում են Dpp- ի բացարձակ մակարդակներին ՝ հիմնականում հետևելով շեմի մոդելին [53]: Աճը ի վերջո ավարտվում է, քանի որ թեքությունը կամ հարաբերական տարածական տարբերությունը աստիճանաբար փոքրանում է գրադիենտի մասշտաբային ընդլայնմամբ (նկ. 2):զ): Երկու դեպքում էլ ենթադրվում է, որ Dpp գրադիենտը գծային է, այնպես, որ թեքությունը հաստատուն է տիրույթում, դրանով բացատրելով աճի միատեսակ օրինաչափությունը: Քանակական չափումները, սակայն, ցույց են տալիս, որ Dpp գրադիենտը ցուցաբերական ձև ունի [30,75]: Միասնական աճը երկրաչափական գրադիենտով բացատրելու համար առաջարկվեց, որ բջիջները զգան իրենց մակերևույթի երկայնքով Dpp- ի կոնցենտրացիայի տարածական տարբերությունը [74]: Եթե ​​աճն իսկապես վերահսկվում էր Dpp գրադիենտի թեքությամբ, ապա Dpp- ից կախված միատեսակ ազդանշանը պետք է հանգեցնի տարածման արգելման: Dpp receptor Tkv (Tkv QD) ակտիվացված ձևի արտահայտում Սպալտի արտահայտչական տիրույթում (սալ) գենը ՝ օգտագործելով սալ-Գալ 4 շարժիչը, սակայն, չփոխեց աճը, այդպիսով հակասելով առաջարկվող մեխանիզմին [29]:

2.6. Աճի հավասարեցման մոդելը

Աճի հավասարեցման մոդելը միայն լուծում է տալիս միատեսակ աճի հարցին: Այն չի լուծում աճի դադարեցման հարցը և, հետևաբար, պատկանում է «թույլատրելի» աճի մոդելների կատեգորիային: Ելնելով իրենց բացահայտումներից, որ թևերի սկավառակի նորմալ զարգացման համար Dpp ազդանշանի գրադիենտ չի պահանջվում et al. [29] առաջարկեց աճի հավասարեցման մոդել: Ըստ իրենց մոդելի, Dpp- ից պահանջվում է միայն սկավառակի միջոցով հավասարակշռել էապես ոչ միատարր տարածումը (նկար 2է): Այսպիսով, նրանք առաջարկում են, որ Dpp- ի բացակայության դեպքում սկավառակի կողային մասերում աճը շատ ավելի ուժեղ է `միջին մասի համեմատ, քանի որ կողային բջիջները անհայտ մեխանիզմով արգելակում են միջնամասի տարածումը (նկար 2է, բաց կապույտ). Dpp-ի առաջարկված դերն այն է, որ այնուհետև հավասարակշռի այս տարբերությունները՝ սահմանափակելով ռեպրեսորային Brk-ի արտահայտությունը սկավառակների կողային մասերում, դրանով իսկ նվազեցնելով տարածումը կողային մասերում և ազատելով միջակայքում տարածման արգելքը [29,74] ( նկար 2է, մուգ կապույտ). Փոխանակ ուղղակիորեն տարածումը խթանելու փոխարեն, այս մոդելում DPP-ն գործում է Brk-ի ճնշումների միջոցով: Աճի հավասարեցման մոդելը վերջերս հաստատվել է այն բացահայտմամբ, որ Dpp-ի ցրման բացակայության դեպքում կողային բջիջները շարունակում են բաժանվել վայրի տիպի հետ համեմատելի արագությամբ, մինչդեռ միջանցքային մասում ձևավորումը և աճը կորչում են [76]:

2.7. Ժամանակավոր դինամիկայի մոդելը

Ի տարբերություն աճի հավասարեցման մոդելի, ժամանակային դինամիկայի մոդելը «ուսանելի» մոդել է: Այս մոդելը հիմնավորվել է այն եզրակացության հիման վրա, որ Dpp աստիճանական գրադիենտի երկարությունը կշռում է աճող թևի սկավառակի երկարությունը և որ դրա ամպլիտուդը աճում է մոտավորապես գծային զարգացման ժամանակ (նկար 2ժ,ես) [30]։ Գրադիենտային այս դինամիկայի արդյունքում հյուսվածքի յուրաքանչյուր բջիջ ժամանակի ընթացքում զգում է Dpp- ի կոնցենտրացիայի նույն հարաբերական փոփոխությունը (նկար 2ժ): Այս դիտարկման հիման վրա ենթադրվում էր, որ ամեն անգամ, երբ բջիջը զգում է Dpp ազդանշանի որոշակի հարաբերական աճ, այն բաժանվում է [30,77]: Քանի որ բոլոր բջիջները զգում են Dpp- ի կոնցենտրացիայի նույն հարաբերական աճը (նկար 2ժ), նման մեխանիզմը կարող է բացատրել միատեսակ տարածումը։ Ավելին, քանի որ Dpp գրադիենտում ամպլիտուդը ժամանակի հետ ավելանում է մոտավորապես գծային (նկար 2)ժ), այս հարաբերական աճին հասնելու համար ավելի երկար ժամանակ է պահանջվում (նկար 2ժ): Հետաքրքիր է, որ դանդաղման կանխատեսված տեմպերը համընկնում էին աճի տեմպի նկատվող անկման հետ: Որպեսզի կարողանան զգալ Dpp կոնցենտրացիայի հարաբերական աճը, բջիջները պետք է հարմարվեն Dpp ազդանշանի յուրաքանչյուր հարաբերական աճին հետևողական ձևով: Հեղինակները փորձարկեցին իրենց մոդելը `պայմանականորեն արտահայտելով Tkv QD- ն, Dpp ընկալիչի հիմնական ակտիվ ձևը բջջային կլոնների մեջ` դրանով իսկ էկզոգենորեն մոդուլացնելով բջիջների կողմից զգացված հարաբերական աճը: Իրոք, տարածման դիտարկված տեմպերն ավելացել են, ինչպես կանխատեսվում էր ժամանակային դինամիկայի մոդելով [30]:

Մոդելը, սակայն, համահունչ չէ այլ փորձարարական դիտարկումներին: Առաջին հերթին սկավառակներ, որոնք մուտանտ են երկուսի համար էլ dpp եւ բրկ overgrow [29]՝ առաջարկելով Dpp-ի թույլատրելի դերը, ինչպես առաջարկվում է աճի հավասարեցման մոդելում: Ավելին, կլոններ, որոնք չունեն խելագար եւ բրկ աճում է համեմատելի վայրի տիպի կլոնների հետ, չնայած Dpp ազդանշանի փոխանցման գենետիկական վերացմանը [78]: Վերջապես, այն եզրակացությունները, որ Dpp- ը չի պահանջվում թևերի կողային սկավառակի աճի համար [76], և թրթուրների զարգացման վերջին կեսի ընթացքում [79] նույնպես վիճում են ժամանակային դինամիկայի մոդելի դեմ: Մինչդեռ վերջին գտածոն մինչդեռ արդեն վիճարկվել է, վերջին աշխատանքն իսկապես ցույց է տալիս, որ Dpp- ի ցածր և միատեսակ մակարդակները բավարար են թևերի սկավառակի նորմալ, միատարր աճը խթանելու համար, մինչդեռ գրադիենտում ազդանշանային ավելի բարձր մակարդակները անհրաժեշտ են միայն նախշերի համար [80-82] .

Dpp գրադիենտի դիտարկվող մասշտաբները թևերի աճող սկավառակի հետ կարելի է բացատրել Dpp գրադիենտի դիֆուզիոն վրա հիմնված ցրվածությամբ [83]: Իրական չափումներին համապատասխան [30], սանդղակը կատարյալ չէ, և մասշտաբի անկատար բնույթը երաշխավորում է, որ գրադիենտը կարող է սահմանել արտահայտության սահմանները: սալ եւ հայրիկ հիմնված մշտական ​​համակենտրոնացման շեմի վրա, չնայած գրադիենտի ամպլիտուդը անընդհատ աճում է [84]: Միևնույն ժամանակ, անկատար մասշտաբավորումը նաև նշանակում է, որ Dpp կոնցենտրացիայի հարաբերական փոփոխությունը տարբերվում է թևերի սկավառակի ամբողջ տիրույթում, այնպես, որ ժամանակային դինամիկայի մոդելը չի ​​հանգեցնի ոչ միատեսակ աճի, ոչ էլ աճի դադարեցման:

2.8. Աճի դադարեցում բջիջների տարբերակման միջոցով

Բջիջների տարբերակումը մեկ այլ հնարավորություն է առաջացնում ժամանակի ընթացքում աճի նվազման տեմպ ստեղծելու համար: Օրգանական համակարգը, որտեղ բջիջների տարբերակման հետևանքները կարող են հատկապես լավ ուսումնասիրվել, դա է Դրոսոֆիլա աչքի սկավառակ (նկար 3ա): Աճը և տարածումը հիմնականում սահմանափակվում են մորֆոգենետիկ ակոսին (MF) առջևի հյուսվածքով [87]: Ոզնու (Hh) կարգավորիչ փոխազդեցությունները, որոնք արտահայտվում են միայն MF- ի հետևում, Dpp- ն, որն արտահայտված է Hh- ով ակտիվացված MF- ում և Homothorax- ը (Hth), որն արտահայտվում է միայն MF- ի դիմաց, հանգեցնում են շրջող ալիքի որը մղում է MF-ն աչքի սկավառակի հետևից դեպի առաջի կողմ (նկ. 3բ) [85,88,89]: Երբ MF-ը հասնում է աչքի սկավառակի առջևի հատվածին, աճը դադարում է: Միայն MF- ի շարժումը կարող է դանդաղեցնել և ի վերջո դադարեցնել աճը: Այնուամենայնիվ, աչքի սկավառակի առջևի մասում աճի տեմպի որոշումը ցույց տվեց, որ աճի տեմպը անընդհատ նվազում է (նկար 3գ) [90]։ Այսպիսով, աճի դադարեցումը չի հաջողվում միայն բջիջների տարբերակմամբ:

Գծապատկեր 3. Աճի վերահսկում է Դրոսոֆիլա աչքի երևակայական սկավառակ: (ա) Աչքի ալեհավաքի երևակայական սկավառակի պատկեր և զարգացման գործընթացի սխեմատիկ պատկերացում: Ապագա աչքն ու ալեհավաքը կազմող հյուսվածքային մասերը պիտակավորված են: Մորֆոգենետիկ ակոսը (ՄՖ, դեղին) սկսվում է հետին լուսանցքում: Զարգացման ընթացքում MF-ն անցնում է հյուսվածքի վրա առաջից հետևի ուղղությամբ: A, առաջի տարածք P, հետին տարածք ՎՄՖ, MF-ի արագությունը Լէջ, հետևի երկարությունը. (բ) Կարգավորող ցանցը, որը վերահսկում է MF- ի առաջընթացը աչքի սկավառակի զարգացման ընթացքում: MF-ի դիմաց նախածննդային բջիջները բազմանում են (սլաք (A)1), մինչդեռ MF բջիջների հետևում տարբերվում են և ի վերջո ձևավորում օմմատիդիան: Hh- ն արտահայտվում է հետևի լուսանցքում (նշվում է նարնջագույնով), որտեղից այն տարածվում է աչքի սկավառակի մեջ (A2) և նախաձեռնում է dpp- ի արտահայտում MF- ում (A3): Dpp ազդանշանները Mad- ի ֆոսֆորիլացման միջոցով pMad- ին (A4): pMad (A5) և Hh (A6) ուժեղացնում են eya- ի արտահայտությունը: Երկուսն էլ pMad միջնորդավորված Dpp ազդանշանը (A7) և Hh ազդանշանը (A8) ճնշում են hth- ի արտահայտությունը: Սկզբում Hth- ը առկա է ամբողջ սկավառակի վրա: Քանի որ Hth մակարդակը նվազում է, նախածննդյան բջիջները կարող են անցնել MF բջիջներ (A9): Hh- ն աջակցում է տարբերակման գործընթացին `հրահրելով MF բջիջների տարբերակումը, որն իր հերթին նախաձեռնում է Hh արտահայտությունը (A10): Այսպիսով, Hh և Dpp/pMad- ը միասին առաջ են մղում MF- ի առաջընթացը: (գ) Աճի տեմպը կ MF հյուսվածքի առջևում անընդհատ նվազում է տարբեր գենոտիպերով աչքի սկավառակի վրա, ինչպես նշված է: Հետևի երկարությունը ԼՊ գծայինորեն կապված է զարգացման ժամանակի հետ [30]: (դ) Համապատասխան է նոսրացման միջոցով աճի վերահսկմանը, աճի տեմպին կ նվազում է հակադարձ համեմատական ​​աչքի սկավառակի ընդհանուր մակերեսին Տ հսկիչ աչքի սկավառակներում (սև և կապույտ): Update- ի կոնցենտրացիայի նվազումը Update receptor Dome- ի լուծելի ձևի արտարգանդային արտահայտմամբ հանգեցնում է ավելի ցածր առավելագույն աճի, սակայն աճի տեմպի կ դեռևս հակադարձ համեմատական ​​է ընկնում աչքի սկավառակի ընդհանուր տարածքին Տ (դեղին): Էկտոպիկ արտահայտություն թարմացնել MF-ի հետևում հակադրվում է Upd-ի նոսրացմանը և հանգեցնում է աճի տեմպի ավելի դանդաղ անկման (կարմիր): (ե) Նոսրացման վրա հիմնված աճի վերահսկման մեխանիզմը: Աչքի սկավառակի զարգացման վաղ փուլերում Upd մոլեկուլները (կարմիր կետերը) արտադրվում են հետևի եզրին (կարմիր գիծ) և տարածվում են փոքր աչքի սկավառակի տիրույթի վրա դիֆուզիայի միջոցով: Թարմացման արտադրությունը դադարում է MF շարժման սկզբում: Ժամանակի ընթացքում աչքի սկավառակի ընդհանուր տարածքի ավելացման արդյունքում Upd-ի կոնցենտրացիան նվազում է նոսրացման միջոցով: Աճի տեմպը, կ, MF-ին նախորդող մասում ուղիղ համեմատական ​​է Upd-ի կոնցենտրացիային (տեսանելի է մուգից բաց մոխրագույնից) և հետևաբար հակադարձ համեմատաբար նվազում է աչքի սկավառակի ընդհանուր տարածքի փոփոխությանը: Արդյունքում տարածքը մեծանում է Δ ժամանակային միջակայքումՏ ավելի քիչ է, ինչը թույլ է տալիս MF-ին հասնել և դադարեցնել աճը: Առջևը ձախ է, իսկ հետևը ՝ աջ: Կանաչ, հետին հատվածը ՝ դեղին, MF գծված գծեր, աճ հաջորդ հաջորդ քայլի ընթացքում: Նկարը և լեգենդը (բ) հարմարեցվել և վերարտադրվել են Ֆրիդի թույլտվությամբ et al. [85] (Հեղինակային իրավունք © 2016 Գիտության հանրային գրադարան): Նկարները (գ–եև լեգենդը (ե) հարմարեցված են Վոլմերից et al. [86]: Վերատպվել է The Company of Biologists (Մեծ Բրիտանիա) թույլտվությամբ:

2.9. Աճի դադարեցում ցիտոկինի նոսրացման միջոցով

Հետաքրքիր է, որ աճի տեմպը հակադարձ համեմատական ​​է ընկնում աչքերի սկավառակի ընդհանուր տարածքին (նկար 3)դ) [90]։ Հետևաբար, աչքի սկավառակում աճի վերահսկումը կարող է իրականացվել ցիտոկինի նոսրացման միջոցով (Նկար 3ե): Իրոք, ցիտոկինը Unpaired (Update) արտահայտվում է միայն MF- ի մեկնարկից առաջ [91], այնպես, որ առավելագույն կոնցենտրացիան սահմանվում է մինչև տարբերակման գործընթացի սկիզբը: Բացի այդ, Update- ը բավական երկարատև է (մոտ 60 ժամ), որ դրա կոնցենտրացիան հիմնականում նվազում է աճից կախված նոսրացմամբ, այլ ոչ թե սպիտակուցների շրջադարձով [86]: Կենսաքիմիական ուսումնասիրությունները հետագայում ցույց են տալիս, որ ներբջջային JAK/STAT ուղին գրեթե գծային կերպով արձագանքում է Updates մակարդակներին [92,93]: Համեմատաբար բարձր դիֆուզիոն գործակիցը հետագայում ապահովում է, որ Upd-ի կոնցենտրացիան մնում է բավականին միատեսակ՝ չնայած աճի տարածական անհամասեռությանը [86]: Համապատասխան նոսրացման մեխանիզմին, Updates- ի ավելի ցածր մակարդակ ունեցող մուտանտներն ունեն փոքր աչքեր, սակայն տարածքի աճի տեմպը դեռ հակադարձ համեմատական ​​է ընկնում աչքի սկավառակի ընդհանուր տարածքին (նկար 3դ, կապույտ և դեղին գծեր) [86]։ MF- ի հետևում էկտոպիկորեն արտահայտող մուտանտներն ունեն շատ ավելի մեծ աչքեր, և աճի տեմպն այլևս չի նվազում տարածքի աճին համամասնորեն (նկար 3դ, կարմիր գիծ) [86]։ Ամփոփելով ՝ դիտարկումները Դրոսոֆիլա աչքի սկավառակը համահունչ է աճի վերահսկմանը `ցիտոկին Update- ի նոսրացմամբ: Մեխանիզմը, սակայն, հատուկ է աչքի սկավառակի համար, քանի որ դրա աճի տվյալները Դրոսոֆիլա թևի սկավառակը չի կարող բացատրվել նոսրացման մեխանիզմով [94]: Այսպիսով, նոսրացման մեխանիզմը չի ներկայացնում աճի դադարեցման ընդհանուր մեխանիզմ, և այլ մեխանիզմներ պետք է գործեն այլ օրգաններում և հավելվածներում:

2.10. Ինտերկալացիոն մոդելը

Ըստ ինտերկալացիոն մոդելի, բջիջներն ունեն որոշակի դիրքային արժեք, որը վերագրվում է յուրաքանչյուր բջիջին իր «ծննդյան» պահին և մնում է անփոփոխ (նկ. 4):ա) [95–98]։ Տարածման/աճի արագությունը կախված է հարեւան բջիջների դիրքային արժեքի տարբերությունից: Դուստր բջիջները փոխկապակցված են սկզբնական բջիջների միջև և ստանձնում են միջանկյալ դիրքային արժեք: Աճը դադարում է, երբ հարևան բջիջների միջև դիրքային արժեքի տարբերությունը փոքր է որոշ շեմից [98]:

Նկար 4. Intercalation մոդելները: (ա) Միջկառուցման մոդելը: Ըստ ինտերկալացիոն մոդելի՝ բջիջներն ունեն դիրքային արժեք, որը նշանակվում է նրանց «ծննդյան» պահին (այստեղ նշված է թվով): Տարածումը ենթադրվում է, որ համաչափ է հարեւան բջիջների դիրքային արժեքի տարբերությանը: «Նորածին» բջիջները խառնվում են բջիջների միջև և ընդունում միջանկյալ դիրքային արժեք: Տարածումը դադարում է, քանի որ հարևան բջիջների դիրքային արժեքների տարբերությունը չափազանց փոքր է դառնում: (բ) Հետադարձ մոդելը առաջարկում է, որ բջիջները հավաքագրվեն թևի քսակի ճակատագրին ՝ սկսած իրան (D)-արևելյան (V) առանցքից: Բջիջները, որոնք հավաքագրվել են թևի պայուսակի ճակատագրում, սկսում են արտահայտվել վեստիգիալ (vg + , կարմիր) և այնուհետև կարող են առաջացնել այս ճակատագիրը հարևան բջիջներում: Միևնույն ժամանակ, այս մեխանիզմը առաջացնում է կենսաքիմիական դիֆերենցիալ, որը վերածվում է տարածման աճի:

Մեխանիզմն ի սկզբանե առաջարկվում էր բացատրել նորածին վերջույթների վերածնումը [36], սակայն կիրառվել է վերականգնող հյուսվածքների լայն տեսականի, ներառյալ Դրոսոֆիլա երևակայական սկավառակներ [99,100]: Ըստ միջմշակման մոդելի ՝ բլաստեմա (այսինքն ՝ ցողունային բջիջների պոպուլյացիան, որը վերածնում է բացակայող հյուսվածքը), որն ի սկզբանե ծածկում է անդամահատված վերջույթը, սահմանում է «հեռավոր», մինչդեռ պրոքսիմալ կոճղը պահպանում է իր դիրքային ինքնությունը: Վերականգնողական աճի ընթացքում բացակայող դիրքային արժեքները աստիճանաբար կներառվեն: Իրոք, նորածին վերջույթների վերածննդի կինետիկան կախված է անդամահատված կառուցվածքի չափից և աճի աճի հետ անկումից, այնպես, որ պրոքսիմալ և հեռավոր անդամահատման վերածնումը տևում է նման ժամանակներ [101]: Օրգանների/հավելվածների չափի վերահսկման միջկառավարման մեխանիզմի ուղղակի փորձնական հաստատումը թույլ տալու համար անհրաժեշտ է սահմանել բջիջների ինքնության գրադիենտի մոլեկուլային մանրամասները: Այստեղ կարևոր կլինի հասկանալ, թե ինչպես կարելի է բջջային ինքնության գրադիենտ հաստատել և հուսալիորեն կարդալ զարգացման մեծ դաշտում, ինչպես նաև արտաքին չափերի վերահսկմամբ խաչաձև քննարկում (այսինքն ՝ ինչպես կբարձրանա դիրքային ինքնությունը, երբ սաղմնային կառուցվածքները տարբերվեն) վերջավոր չափեր, օրինակ՝ հասանելի սննդանյութերի տարբերությունների պատճառով):

2.11. Հետադարձ առաջացման մոդելը

Ինչպես intercalation մոդելը, feed-forward մոդելը հիմնված է բջիջ-բջիջ փոխազդեցությունների վրա, բայց նաև կախված է Wingless (Wg) որպես մորֆոգեն: Առաջարկված Zecca & amp Struhl [102–104] -ի կողմից, այս մոդելի հիմքում ընկած է այն գաղափարը, որ բջիջները հավաքագրվում են թևի ճակատագրին ՝ սկսած դորսովենտրալ (DV) սահմանից (նկար 4բ): Թև-տոպրակ-սելեկտոր գենի նախնական ձգանից հետո վեստիթիալ (վ) և անթեւ (wg, a Wnt morphogen) DV ազդանշանային կենտրոնի կողմից, թևի քսակի շրջանի աճը կընթանա կրկնակի գործընթացի միջոցով. ոչ քսակ բջիջների հավաքագրում վգ-քսակային բջիջներ արտահայտող և այս ոչ քսակ բջիջներում բազմացման ինդուկցիա: Թևի զարգացման «ընդլայնման» մեխանիզմը պահանջում է ճարպի և D- ի արտահայտման կտրուկ դիֆերենցիալի ստեղծում ընդլայնվող տիրույթի եզրին, ինչը հանգեցնում է Հիպո ճանապարհի ճնշմանը և Yki- ի ակտիվացմանը: Այս ակտիվացման արդյունքը կլինի երկակի՝ տարածման ավելացում և դրա սկիզբ վ արտահայտությունը, դրանով իսկ թույլ տալով հետադարձ կապի ինդուկցիա վ և թևի ընդլայնում. Չնայած այս հեղինակները ուղղակիորեն չեն անդրադառնում նրանց, սակայն նրանց մոդելը կարող է սկզբունքորեն բացատրել աճի դադարեցումը wg wg հայտնաբերվում է որպես գրադիենտ `առավելագույնը քսակի կենտրոնում (DV- ի երկայնքով) և նեղանում դեպի իր ծայրամասը: Հետևաբար, եթե լիներ քանակական կախվածություն Wg-ից, ապա ընդլայնումը և դրա հետ կապված տարածումը կփչանան այնքան ժամանակ, մինչև Wg-ի կոնցենտրացիան ընկնի շեմի տակ (այսինքն՝ սկավառակի կենտրոնից հեռու): Այս մոդելը, սակայն, վերջերս մարտահրավեր է նետել այն եզրակացության վրա, որ Wg- ի մեմբրանով կապված ձևը կարող է փոխարինել էնդոգեն, ցրվող սպիտակուցը, ինչը հանգեցնում է նորմալ ձևի և չափի թևերի [105]: Այնուամենայնիվ, կարելի էր պատկերացնել, որ նմանատիպ արդյունք կառաջանար, եթե ժամանակի ընթացքում. wg արտահայտությունը աստիճանաբար ավելի է սահմանափակվում սկավառակի կենտրոնով, մի բան, որը հավանաբար այդպես է [105–107]: Այնուամենայնիվ, այս մոդելը ոչ բացատրում է, թե ինչպես է տարածումը պահպանվում ամբողջ պայուսակում `ընդլայնվող ճակատի հետևից, ոչ էլ տարածման տեմպերի դանդաղում` զարգացման ժամանակի հետ:

2.12. Մոդելներ, որոնք հիմնված են հյուսվածքների մեխանիկայի վրա

Ի վերջո, մեխանիկական սահմանափակումներ են առաջարկվել աճը սահմանափակելու համար: Երկու նման, բայց դեռ հստակ մեխանիկական մոդելներ են առաջ քաշվել: 2005 թվականին Շրայմանը [108] առաջարկեց, որ բջիջների կլոնը, որն ավելի արագ է աճում, քան շրջապատը, մեխանիկական սթրես է ապրում: Ենթադրելով ենթադրյալ «ինտեգրալ-հետադարձ», որի դեպքում այս սթրեսը նվազեցնում է բջիջների աճի տեմպը, Շրայմանը [108] ենթադրում է, որ դա կհանգեցնի սկավառակի վրա աճի միատեսակ արագության: Ավելի ուշ մոդելը ընդլայնվեց՝ հաշվի առնելով նաև աճի դադարեցումը [109]: Այս մոդելում աճը դադարում է, քանի որ կողային մասերի բջիջները դադարում են տարածվել, երբ դրանք ընկնում են Dpp շեմից ցածր: Հյուսվածքի կողային մասերում բջջային ցիկլի դադարեցումը հանգեցնում է սկավառակի կենտրոնում մեխանիկական սթրեսի ավելացմանը: Ենթադրվող հետադարձ կապի հիման վրա, որ սթրեսը նվազեցնում է աճի տեմպը, դա, ի վերջո, հանգեցնում է աճի դադարեցման [109]: Կարևոր է, որ այս մոդելը պահանջում է, որ Dpp գրադիենտը չհամապատասխանի հյուսվածքի չափին [109] ՝ հակասելով Ուարտլիքի եզրակացություններին et al. [30].

Aegerter-Wilmsen- ի մշակած մոդելները et al. [110,111], ընդհակառակը, պահանջում է ճիշտ հակառակը ՝ գրադիենտի մասշտաբավորումը: Հուֆնագելի, Շրայմանի և գործընկերների մոդելների նման [108,109], նրանք ենթադրում են, որ սեղմումը հանգեցնում է աճի արգելակման: Ավելին, նրանք ենթադրում են, սակայն, որ որոշակի շեմից ավելի ձգվելը առաջացնում է աճ [110]: Վերջապես, նրանք պահանջում են մեկ այլ մորֆոգենի գրադիենտ ուղղահայաց Dpp- ին, որը նույնպես կշեռք է հյուսվածքի չափսերով: Այսպիսով, այս մոդելը ներառում է հիմնական գենետիկական տվյալները, որոնք օգտագործվում են առաջընթացի մոդելը կառուցելու համար (տես վերևում): Այս ենթադրությունների հիման վրա նրանք կառուցեցին մի մոդել, որում Dpp- ն դրդում է սկավառակի միջնամասի աճ: Այս աճը հանգեցնում է կողային մասերի շոշափելի ձգման։ Թեև այս ձգումը առաջացնում է աճ այդ հատվածներում, այն չի կարող ամբողջությամբ փոխհատուցել սեղմումը (նկար 5)ա): Որպես զուտ արդյունք, սկավառակի կենտրոնական մասի սեղմումը մեծանում է, ինչը ի վերջո հանգեցնում է աճի դադարեցմանը [110,111]: Իրոք, սկավառակի կենտրոնի և ծայրամասի միջև տարածման դիֆերենցիալ տեմպերը, ինչպես նաև լարվածության և ճնշման անհավասար բաշխումը հետագայում փորձնականորեն նկատվել են թևի սկավառակում՝ առավելագույն սեղմումով և ամենաբարձր հիդրոստատիկ ճնշմամբ կենտրոնում (նկ. 5):բ) [113–115]: Հիմնական դիտարկումներից մեկը, որը այս մոդելները չեն կարողանում բացատրել, հյուսվածքի առաջի և հետևի հատվածների ինքնավար աճն է: Ինչպես նկարագրված է վերևում, եթե որևէ կուպե ունի a Րոպե մուտացիա, երկու խցիկներն աճում են տարբեր արագություններով, մինչդեռ սկավառակի վերջնական չափը համեմատելի է վայրի տիպի սկավառակների հետ [45]: Սա հեշտությամբ չի բացատրվում առաջարկվող մոդելներով: Անհայտ է նաև, թե որքանով պետք է հաշվի առնել սկավառակի իրական ճկումը, կամ արդյոք մեխանիկական սթրեսի դիտարկվող բաշխումն իրականում կարող է հանգեցնել այդ ճոճանակի:

Նկար 5. Աճի վերահսկում մեխանիկական հետադարձ կապի միջոցով: (ա) [110] -ում մշակված մոդելի նկարազարդում: The Դրոսոֆիլա թևի սկավառակի քսակն այստեղ ցուցադրվում է որպես իդեալականացված շրջան: Սկզբում աճի մեծ մասը տեղի է ունենում սկավառակի կենտրոնում (ձախ, մուգ կարմիր, որը ցույց է տալիս աճի ավելի բարձր տեմպ): Սկավառակների աճի հետ մեկտեղ կողային բջիջները ձգվում են (կանաչ), ինչը նպաստում է աճին այս շրջանում: Սա, սակայն, անբավարար է ձգումը փոխհատուցելու համար: Հետևաբար, սկավառակի կենտրոնը սեղմվում է (կապույտ) ՝ նվազեցնելով աճի տեմպը: Աճը դադարում է, երբ բջիջներն այլևս չեն կարող ճնշման միջոցով հաղթահարել արգելակող ազդեցությունը: (բ) Հիդրոստրատիկ ճնշման տարբերությունների բաշխում, ΔՊ, թևի սկավառակում, ինչպես ենթադրվում է բջջի երկրաչափություններից. հիդրոստատիկ ճնշման տարբերությունը թևի սկավառակի կենտրոնում ավելի բարձր է, քան ծայրամասում, արժեքները նորմալացվել են այնպես, որ հյուսվածքի միջին ճնշման տարբերությունը զրո է (գունավոր գիծ): Հարմարեցված է Ishihara & amp Sugimura- ից [112]: Վերատպվել է Elsevier-ի թույլտվությամբ։ Կշեռքի սանդղակ, 20 մկմ:

Վերջապես, բաց հարց է, թե ինչպես են բջիջները զգում իրենց միջավայրի մեխանիկական կարգավիճակը: Վերջին աշխատանքը ներառում է Հիպպո ճանապարհը [116,117] որպես մեխանիզմի կարևոր բաղադրիչ, որն անհրաժեշտ է մեխանիկական սթրեսի հետադարձ կապի համար: Մեջ Դրոսոֆիլա, գործող ցիտոկմախքի կարգավիճակը (որը վերահսկում է բջիջների ձևը և միոզինի հետ միասին կարգավորում է բջջային ծառի կեղևի ռեոլոգիական հատկությունները) կապված է Հիպպո ուղու՝ աճի կարգավորիչի հետ [118,119]: Մեխանիկական փոխադրման մեջ Hippo- ի ուղու դերը առաջարկվել է նաև ողնաշարավոր բջիջներում [120,121]: Հետևաբար, կա պոտենցիալ ազդանշանային/կենսաքիմիական կապ մեխանիկական ուժերի և աճի վերահսկման միջև: Վերջերս Parker & amp Struhl [122] - ը ցույց տվեց, որ Դրոսոֆիլա Թևի սկավառակը, Yki-ն կարող է մեկուսացվել միջուկում, այդպիսով անհնարին դարձնել մուտքի իր տառադարձման թիրախները, քանի դեռ TOR ուղին (որը կապում է սնուցումը աճի հետ) ակտիվ չէ: Հետևաբար, Հիպպո ճանապարհի գործունեությունը, և հատկապես Yki-ի կարգավորման միջոցով, թվում է, թե գտնվում է մեխանիկական ուժերի, սնուցման և աճի խաչմերուկում, և այդպիսով դառնում է կենտրոնական փուլ աճի ավարտի կարգավորման ուսումնասիրության մեջ (այսինքն՝ չափը): ): Այնուամենայնիվ, վերջին աշխատանքը Մա et al. [123], որի ընթացքում թևի էպիթելիումի մեխանիկական լարվածությունը փոխվել է ՝ փոխելով իր բազալային թաղանթի կազմը, վիճարկում է այն գաղափարը, որ մեխանիկական հետադարձ կապը հիմնական դերն ունի աճի վերահսկման գործում:

3. Եզրակացություն և հեռանկար

Օրգանների միջև աճը համակարգելու և որոշակի վերջնական չափով աճը դադարեցնելու ունակությունը բարդ օրգանիզմների էվոլյուցիայի հիմնական քայլն էր: Այս վերանայման շրջանակներում մենք ներկայացրել ենք այն մոդելներն ու գաղափարները, որոնք առաջարկվում են բացատրել զարգացման աճի դադարեցումը Դրոսոֆիլա թևի և աչքի սկավառակ: Չնայած այս մոդելներից յուրաքանչյուրին այստեղ վերաբերվում էին առանձին, հնարավոր է, որ մի քանի մեխանիզմների համակցումը նպաստի աճի դադարեցման վերահսկողությանը:

Հետաքրքիր է, որ աճի դադարեցման վերջնական մեխանիզմ(ներ) էլ լինի, այն պետք է թույլ տա հեշտությամբ հարմարվել շրջակա միջավայրի պայմանների և օրգանիզմի ընդհանուր չափերի փոփոխություններին, միաժամանակ անսովոր կայուն լինելով մի շարք խանգարումներով, ներառյալ բջիջների չափի և թվի խանգարումները: Ընդհանուր կանոններից մեկը, որը տարածված է կենդանական աշխարհում, այն է, որ աճի տեմպերը նվազում են, քանի որ զարգացումը զարգանում է [124]: Աճի դադարեցման մեխանիզմի հետագա որոնումները պետք է հաշվի առնեն փորձարարական դիտարկումների լայն շրջանակը և իդեալականորեն բացատրեն հյուսվածքների, տեսակների և էկոլոգիական/բնապահպանական և փորձարարական պայմանների աճի դինամիկան:


Նյութեր եւ մեթոդներ

Ռեակտիվի տեսակը (տեսակը) կամ ռեսուրսըՆշանակումԱղբյուր կամ հղումՆույնացուցիչներԼրացուցիչ տեղեկություն
ՀակամարմինԱռնետ հակահայկական մկնիկ CD45 (30-F11)ԿենսալեգենդԿատու#: 103108 RRID: AB_312972FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինԱռնետ հակահայկական մկնիկ CD45 (30-F11)ԿենսալեգենդԿատու#: 103114 RRID: AB_312978FACS (1:600 ​​100 մկլ մեկ թեստի համար)
ՀակամարմինԱռնետների հակա-մկնիկ CD11b (M1/70)Բեկտոն Դիկինսոն- BDԿատու#: 565976 RRID: AB_2721166FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինԱռնետ հակամկնիկ F4/80 (BM8)ԿենսալեգենդCat#՝ 123114 RRID՝ AB_893490FACS (1:600 ​​100 մկլ մեկ թեստի համար)
ՀակամարմինԱռյուծի հակամկնային Ly6c (HK1.4)ԿենսալեգենդԿատու#: 128036 RRID: AB_2562352FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինԱռնետների հակա-մուկ I-A/I-E հակամարմին (M5/114.15.2)ԿենսալեգենդCat#՝ 107632 RRID՝ AB_10900075FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինՀամստերային հակամկնային CD11c (N418)ԿենսալեգենդԿատու#: 117324 RRID: AB_830646FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինՀամստեր հակամկնիկի CD103 (2E7)ԿենսալեգենդԿատու#: 121416 RRID: AB_1574957FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինՄկնիկի հակամկնիկի CD209 (կլոն՝ MMD3)Thermo Fisher ScientificCat#՝ 50-2094-82 RRID:AB_11219065FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինԱռնետների հակամկնիկի CD326 (G8.8)ԿենսալեգենդCat#՝ 118231 RRID՝ AB_2632774FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինՄկնիկ հակա-մկնիկ CD207 (կլոն ՝ 4C7)ԿենսալեգենդԿատու#: 144204 RRID: AB_2561498FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինՄկնիկ հակա-մկնիկ CD45.1 (A20)ԿենսալեգենդCat#՝ 110726 RRID՝ AB_893347FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինՄկնիկի հակամկնիկ CD45.2 (104)ԿենսալեգենդCat#՝ 109830 RRID՝ AB_1186103FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինԱռնետների դեմ մկնիկ CD3 (17A2)ԿենսալեգենդԿատու#: 100306 RRID: AB_312670FACS (1:500 100 մկլ մեկ թեստի համար)
ՀակամարմինԱռնետների դեմ մկնիկ CD4 (GK1.5)ԿենսալեգենդCat#՝ 100414 RRID՝ AB_312699FACS (1:600 ​​100 մկլ մեկ թեստի համար)
ՀակամարմինԱռնետների հակամկան CD8 (53–6.7)ԿենսալեգենդԿատու#: 100722 RRID: AB_312761FACS (1:600 ​​100 մկլ մեկ թեստի համար)
ՀակամարմինԱռնետ մկնիկ FOXP3 (MF-14)ԿենսալեգենդCat#՝ 126407 RRID՝ AB_1089116FACS (1:600 ​​100 մկլ մեկ թեստի համար)
ՀակամարմինՀամստեր հակամկնիկի ICOS (15F9)ԿենսալեգենդԿատու#: 107705 RRID: AB_313334FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինԱռնետների հակա-IFN-գամմա
(XMG1.2)
ԿենսալեգենդԿատու#: 505810 RRID: AB_315404FACS (1: 600 100 մկլ յուրաքանչյուր փորձարկման համար)
ՀակամարմինFc-R բլոկ (2.4G2)ԻնքնագործՀ/հԱրգելափակման քայլ (1: 100 1000 մլ մեկ նմուշի համար)
Քիմիական միացություն, դեղամիջոցԲրեֆելդին ԱՍիգմա-ՕլդրիչԿատու#: B765110 մկգ/մլ
Քիմիական միացություն, դեղամիջոցPhorbol 12-myristate 13-acetateՍիգմա-ՕլդրիչԿատու#: 7934610 մկգ/մլ
Քիմիական միացություն, դեղամիջոցԻոնոմիցինՍիգմա-ՕլդրիչԿատուի թիվ՝ I063410 մկգ/մլ
Քիմիական միացություն, դեղամիջոցԿոլագենազ ԴՌոշCat#՝ 110888820011 մգ/մլ
Քիմիական միացություն, դեղամիջոցDispase IIԳիբկոԿատու#: 171050411 U/մլ
Քիմիական միացություն, դեղամիջոցՖիկոլ-ՊակեGE HealthcareCat#՝ 17144003
Քիմիական միացություն, դեղամիջոցՊերկոլՄերկԿատու#: P4937-500ML
Քիմիական միացություն, դեղամիջոցԴիֆթերիայի տոքսինՍիգմա-ՕլդրիչCat#՝ D056420 նգ DT/գ մարմնի քաշ, i.p.
Քիմիական միացություն, դեղամիջոցՏամոքսիֆենՍիգմա-ՕլդրիչԿատու#: T56484 մգ TAM 5 օր անընդմեջ բերանի խոռոչով մեծահասակների պիտակավորման համար: Հղի մկներին (E7.5) մեկ անգամ ներարկել են 16 մգ TAM սաղմի մակնշման համար:
Քիմիական միացություն, դեղամիջոցIMDMԹերմո ՖիշերCat#՝ 12440046
Քիմիական միացություն, դեղամիջոցԱմոնիումի թիոցիանատՍիգմա-ՕլդրիչԿատու#: 221988
Քիմիական միացություն, դեղամիջոց5,5'-Դիթիո-բիս- 2-նիտրոբենզոյաթթու (DNTB)Սիգմա-Օլդրիչ
(Lancaster Synthesis)
Կատու#: D8130
Քիմիական միացություն, դեղամիջոց1-ֆտոր-2,4-
դինիտրոբենզոլ
(DNFB)
Սիգմա-ՕլդրիչԿատու#: D1529
Քիմիական միացություն, դեղամիջոցԱցետոնՍիգմա-ՕլդրիչԿատու#: 650501
Քիմիական միացություն, դեղամիջոցՍապոնինՍիգմա-ՕլդրիչԿատու#: S7900
Քիմիական միացություն, դեղամիջոցTRIzol ռեակտիվThermo Fisher ScientificԿատու#: 15596026
Առևտրային անալիզ կամ հավաքածուRNA պարզ ընդհանուր RNA հավաքածուTiangen Biotech LtdԿատու#: DP419
Առևտրային վերլուծություն կամ հավաքածուFoxp3 ներկման բուֆերէլեկտրոնագիտությունԿատու#: 00-5521-00
Առևտրային անալիզ կամ հավաքածուCytofix/cytopermէլեկտրոնագիտությունԿատու#: 51-2090KZ
Առևտրային անալիզ կամ հավաքածուOvation Ունիվերսալ RNA- հաջորդական համակարգNuGEN տեխնոլոգիաներԿատու#: 0343–32
Առևտրային անալիզ կամ հավաքածուԴՆԹ բարձր զգայունության ռեագենտների հավաքածուAgilent, Սանտա Կլարա, Կալիֆորնիա, ԱՄՆԿատու#: 5067–4626
Առևտրային անալիզ կամ հավաքածու10× Chromium Controller10X GenomicsԿատու թիվ՝ 120263
Առևտրային անալիզ կամ հավաքածուChromium Single Cell v3 ռեակտիվների հավաքածու10X գենոմիկաԿատու #: PN-100009
Ծրագրային ապահովում, ալգորիթմFlowJoTreeStarFlowJo 10.6
RRID:SCR_008520
Softwareրագրային ապահովում, ալգորիթմGraphPad պրիզմաGraphPad ծրագրակազմGraphPad 9.0
RRID:SCR_002798
Լարում, լարվածության ֆոն (մուկ)C57BL/6JJեքսոնի լաբորատորիաԲաժնետոմս Nr. 000664
RRID: IMSR_JAX: 000664
Լարում, լարվածության ֆոն (մուկ)B6.SJL-Ptprc a Pepc բ /Տղա ՋՋեքսոնի լաբորատորիաՖոնդային համարը 002014 թ
RRID: IMSR_JAX: 002014
Լարում, լարում ֆոն (մկնիկ)Հավաքածու MerCreMer /Rosa26-LSL-eYFP (կոչվում է Հավաքածու MerCreMer /R26)Նանյան տեխնոլոգիական համալսարան, Սինգապուր
Շենգ և այլոք, 2015 թ
Լարում, լարվածության ֆոն (մուկ)Clec9A-DTRՆանյան տեխնոլոգիական համալսարան, Սինգապուր
Պիվա և այլք, 2012 թ
Լարում, լարում ֆոն (մկնիկ)CD207-DTRSIgN, A*Star, Սինգապուր
Kissenpfennig et al., 2005
Լարում, լարվածության ֆոն (մուկ)DC-SIGN-DTRՆանյան տեխնոլոգիական համալսարան, ՍինգապուրSheng et al., այս թուղթ
Լարում, լարվածության ֆոն (մուկ)DC-SIGN-DTR-Kit MerCreMer /R26Nanyang տեխնոլոգիական համալսարան, ՍինգապուրSheng et al., Այս թերթը
Լարում, լարվածության ֆոն (մուկ)B6.129S2-Cd207 tm2 Մալ /J (Lang-EGFP)Jեքսոնի լաբորատորիաՖոնդային համարը 016939
RRID:IMSR_JAX:016939
Հաջորդական հիմքով ռեագենտIfng_FԱյս թուղթըPCR այբբենարաններGACAATCAGGCCATCAGCAAC
Հերթական վրա հիմնված ռեագենտIfng_RԱյս թուղթըPCR այբբենարաններACTCCTTTTCCGCTTCCTGAG
Հաջորդական հիմքով ռեագենտIl6_FԱյս թուղթըPCR այբբենարաններTGATGGATGCTACCAAACTGG
Հերթական վրա հիմնված ռեագենտIl6_RԱյս թուղթըPCR այբբենարաններCCAGGTAGCTATGGTACTCCAGA
Հերթական վրա հիմնված ռեագենտՏնֆա_ՖԱյս թուղթըPCR այբբենարաններAATTCGAGTGACAAGCCTGTAG
Հերթական վրա հիմնված ռեագենտՏնֆա_ՌԱյս թուղթըPCR այբբենարաններTTGAGATCCATGCCGTTGG
Հաջորդական հիմքով ռեագենտIl1b_FԱյս թուղթըPCR այբբենարաններGGGCCTCAAAGGAAAGAATC
Հաջորդական հիմքով ռեագենտIl1b_RԱյս թուղթըPCR այբբենարաններTTCTTCTTTGGGTATTGCTTGG
Հերթական վրա հիմնված ռեագենտVegfa_FԱյս թուղթըPCR այբբենարաններGCAGCTTGAGTTAAACGAACG
Հաջորդական հիմքով ռեագենտՎեգֆա_ՌԱյս թուղթըPCR այբբենարաններGGTTCCCGAAACCCTGAG
Հերթական վրա հիմնված ռեագենտHBEGF_FԱյս թուղթըPCR այբբենարաններATGACCACACAACCATCCTG
Հաջորդական հիմքով ռեագենտHBEGF_RԱյս թուղթըPCR այբբենարաններCCAGCAGACAGACAGATGACA
Հաջորդական հիմքով ռեագենտcd209a_FԱյս թուղթըPCR այբբենարաններCCAAGAACTGACCCAGTTGAA
Հաջորդական հիմքով ռեագենտcd209a_RԱյս թուղթըPCR այբբենարաններCTTCTGGGCCACACAGAGAAGA
Հաջորդական հիմքով ռեագենտActb_FԱյս թուղթըPCR այբբենարաններAAGGCCAACCGTGAAAAGAT
Հերթական վրա հիմնված ռեագենտActb_RԱյս թուղթըPCR այբբենարաններCCTGTGGTACGACCAGAGGCATACA

C57BL/6J և B6. SJL-Ptprc a Pepc բ /BoyJ (B6 CD45.1) ստացվել է The Jackson Laboratory- ից (ԱՄՆ): Հավաքածու MerCreMer /Rosa26-LSL-eYFP (կոչ Հավաքածու MerCreMer /R26) և Clec9A-DTR մկները ստեղծվեցին, ինչպես նկարագրված էր նախկինում (Piva et al., 2012 Sheng et al., 2015): Kit MerCreMer /R26 մկները հետամնաց անցան DC-SIGN-DTR մկների հետ ՝ DC-SIGN-DTR-Kit MerCreMer /R26 մկներ ստանալու համար: B6.129S2-Cd207 tm2Mal /J մկները բուծվել և տեղավորվել են Մալագանի բժշկական հետազոտությունների ինստիտուտում (Վելինգթոն, Նոր Զելանդիա): CD207-DTR մկները ստացվել են Սինգապուրի իմունոլոգիական ցանցից (SIgN A*Star, Սինգապուր):

DC-SIGN DTR մկները ստեղծվել են հետևյալ կերպ. IRES-DTR միաձուլման գենը տեղադրվել է BAC RP24-306K4- ում DC-SIGN գենի տեղակայման 3'-UTR տարածաշրջանում: 7 - գործիչ հավելում 1A): Գենի թիրախավորման վեկտորը գծայնացվեց և էլեկտրատվեց Balb/C սաղմնային ցողունային բջիջների մեջ (ES) և ճիշտ վերամիավորված ES գաղութներն ընտրվեցին PCR- ով: Գենին ուղղված ES բջիջները ներարկվել են C57BL/6 բլաստոցիստների մեջ և տեղափոխվել կեղծ հղի մոր ձվաբջջի մեջ: F0 արու քիմերա մկները զուգավորվեցին F1 Balb/C էգերի հետ ՝ F1 Balb/C DC-SIGN DTR մկներ ձեռք բերելու համար: Այս մկները հետագայում անցան C57BL/6 սերնդի վրա 12 սերունդ `այս ուսումնասիրության մեջ օգտագործված C57BL/6 DC-SIGN մկնիկ ստեղծելու համար:

Բոլոր մկները, բացառությամբ B6.129S2-Cd207 tm2Mal /J մկները, աճեցվել և պահպանվել են Նանյանգ տեխնոլոգիական համալսարանի (Սինգապուր) հատուկ կենդանիներից `առանց պաթոգենների: Սինգապուրում մկների հետ կապված բոլոր ուսումնասիրություններն իրականացվել են Կենդանիների լաբորատոր հետազոտությունների ազգային խորհրդատվական կոմիտեի առաջարկություններին համապատասխան և բոլոր արձանագրությունները հաստատվել են Նանյան տեխնոլոգիական համալսարանի Կենդանիների խնամքի և օգտագործման ինստիտուցիոնալ կոմիտեի կողմից (ARF-SBS/NIE A- 0133 A-0257 A0126, A-18081): Նոր alandելանդիայում կատարված կենդանիների աշխատանքի համար փորձնական արձանագրությունները հաստատվել են Վելտինգոնի Վիկտորինայի համալսարանի կենդանիների էթիկայի հանձնաժողովի կողմից և կատարվել են ինստիտուցիոնալ ուղեցույցներին համապատասխան:

TAM-ի ազդեցությամբ ճակատագրի քարտեզագրման մկնիկի մոդելներ

Kit MerCreMer /R26 և DC-SIGN-DTR- Kit MerCreMer /R26 ճակատագրի քարտեզագրման մկներն օգտագործվել են մաշկի հետ կապված DC ենթաբազմությունների հստակ շրջանառության մակարդակը վերահսկելու համար: TAM- ի ներարկումից հետո YFP պիտակը կառաջացվի c-kit- արտահայտող բոլոր բջիջներում, որոնք հիմնականում բնակվում են BM- ում, և այդ բջիջները կպահպանեն YFP- ի պիտակը BM- ից դուրս գալուց և սերմանվել դեպի ծայրամաս: Յուրաքանչյուր մկան 5 օր անընդմեջ ընդունվել է 4 մգ TAM (Sigma-Aldrich, St. Louis, MO, USA) բերանի խոռոչի միջոցով մեծահասակների պիտակավորման համար, ինչպես նախկինում նկարագրված է (Sheng et al., 2015): Հղի մկներին (E7.5) մեկ անգամ ներարկել են 16 մգ TAM սաղմի մակնշման համար:

DT ներարկում

DC-SIGN-DTR pos և DC-SIGN-DTR neg մկները ներերկրային ներարկումով ներարկվել են 20 նգ/գ DT (Sigma-Aldrich) `DC-SIGN արտահայտող բջիջները սպառելու համար: Օգտագործվել են երկու տարբեր DT ներարկման արձանագրություններ (Նկար 7Ա): Կարճաժամկետ սպառման արձանագրության համար մկներին ներարկվել է i.p. −2 և −1 օրերին՝ հյուսվածքների հավաքումից առաջ: Երկարատև արձանագրության համար DT-ն ներարկվում էր շաբաթական մեկ անգամ՝ հյուսվածքների հավաքումից 5 շաբաթ առաջ:

BM քիմերաների սերունդ

Քիմերիկ մկները ստեղծվել են ստացող C57BL/6 կամ DC-SIGN-DTR մկների ճառագայթման միջոցով (CD45.2 +) `550 cGy երկու դեղաչափով, 4 ժամ հեռավորության վրա: Այնուհետեւ, 10 6 B6.Ly5.1 (CD45.1 +) BM բջիջները ներարկվել են ներերակային (i.v.), բուժումից 24 ժամ անց: Մկներին թույլ տրվեց վերականգնել վերլուծությունից 1 -ից 4 ամիս առաջ:

Էպիդերմիսի, մաշկային և LN բջիջների մեկուսացում

Մկնիկի ականջները կտրվեցին և բաժանվեցին մեջքի և որովայնի կեսի ՝ օգտագործելով նուրբ պինցետ: Թիկունքային և որովայնային կեսերը (էպիդերմիսի կողմը դեպի վեր) 1 ժամ շարունակ ինկուբացվել են 37 ° C ջերմաստիճանում 1 մլ IMDM- ում (Thermo Fisher Scientific, Waltham, MA, ԱՄՆ) 1 U/ml Dispase II (Thermo Fisher Scientific ): Էպիդերմիսը և դերմիսը առանձնացվել են նուրբ ֆորսպսերի միջոցով, կտրել փոքր կտորների և մարսել ևս 1 ժամ 37 ° C ջերմաստիճանում 1 մգ/մլ կոլագենազ D- ում (Ռոշ, Բազել, Շվեյցարիա): Մեկ բջջային կախոցներ ստանալու համար մարսված հյուսվածքը անցել է 40 մմ բջիջների քամիչով: Մաշկը քայքայող ականջային LN- ների մշակման համար մասնատված LN- երը մանրացվել և ինկուբացվել են 1 մգ/մլ կոլագենազ D- ում 60 րոպե 37 ° C ջերմաստիճանում:

Հակամարմիններ

Օգտագործվել են հետևյալ հակամարմինները՝ հակամկնիկի CD45 (30-F11), մկնիկի դեմ CD11b (M1/70), հակամկնիկի F4/80 (BM8), մկնիկի դեմ Ly6c (HK1.4), մկնիկի դեմ CD11c: (N418), հակամկնային IA/IE (M5/114.15.2), մկնիկի դեմ CD103 (2E7), մկնիկի դեմ CD326 (G8.8), մկնիկի դեմ CD207 (4C7), մկնիկի դեմ CD45.1 (A20), մկնիկի դեմ CD45.2 (104): Նրանք բոլորը գնվել են Biolegend- ից (Սան Դիեգո, Կալիֆոռնիա, ԱՄՆ): Հակամկնային CD45 միկրոբլիկներ Milteny- ից (Bergisch Gladbach, Գերմանիա): Բոլոր հակամարմինները օգտագործվել են արտաբջջային ներկերի համար, բացառությամբ հակ CD207 Ab- ի, որն օգտագործվել է ներբջջային պիտակավորման համար `բջիջները համապատասխանաբար 2% պարաֆորմալդեհիդով և 0.05% սապոնինով ամրացնելուց և թափանցելուց հետո:

Մաշկի հետ կապված DC ենթաբնակչության հոսքի ցիտոմետրիայի վերլուծություն

Միաբջիջ էպիդերմային, մաշկային կամ LN հյուսվածքների կախոցները նախապես ինկուբացվել են 10 մգ/մլ հակա-Fc ընկալիչի հակամարմիններով (2.4G2) սառույցի վրա 20 րոպե: Հետո, կախոցները հետագայում ինկուբացիայի ենթարկվեցին ֆտորոքրոմով պիտակավորված հակամարմիններով 4 ° C ջերմաստիճանում 20 րոպե, նախքան լվացվեն և նորից կասեցվեն PBS/2% FCS- ում `հինգ լազերային հոսքի ցիտոմետրի վրա վերլուծության համար (LSR Fortessa BD Bioscience, Սան Խոսե , Կալիֆոռնիա, ԱՄՆ): Տվյալները վերլուծվել են FlowJo ծրագրով (TreeStar, Ashland, OR, ԱՄՆ), իսկ UMAP վերլուծությունը կատարվել է ՝ օգտագործելով FlowJo UMAP հավելվածը:

ScRNA-seq վերլուծություն

Իմունային բջիջները հարստացվել են մաշկային միաբջիջ կախոցից ստացված հակա-մկնիկի CD45 միկրոբլիկների միջոցով: Հակիրճ, հարստացված CD45 + մաշկային բջիջները բեռնվեցին քրոմի միկրոհեղուկ չիպերի մեջ v3 քիմիայով և շտրիխ կոդավորվեցին 10 × Chromium Controller- ի հետ (10X Genomics, Pleasanton, CA, ԱՄՆ): Շտրիխ կոդավորված բջիջներից ստացված ՌՆԹ-ն հետադարձ տառադարձման ենթարկվեց և հաջորդականեց գրադարանները, որոնք կառուցված էին ռեագենտներով `կառուցված Chromium Single Cell v3 ռեակտիվների հավաքածուից (10X Genomics)` ըստ արտադրողի ցուցումների: Գրադարանի հաջորդականությունը կատարվել է Novogene Co., Ltd-ում (Tianjin Novogene Technology Co., Tianjin, Չինաստան) Illumina HiSeq 2000-ի հետ՝ համաձայն արտադրողի ցուցումների (Illumina, San Diego, CA, USA):

Մեկ բջջային տվյալների վերլուծություն

FastQC- ն օգտագործվել է չմշակված ընթերցումների որակի վերաբերյալ հիմնական վիճակագրություն կատարելու համար: Հում ընթերցումները ապամուլտիպլեքսավորվել և քարտեզագրվել են հղման գենոմին 10X Genomics Cell Ranger խողովակաշարով `օգտագործելով կանխադրված պարամետրեր: Բոլոր ներքևի մեկ բջջային անալիզները կատարվել են Cell Ranger-ի և Seurat-ի միջոցով, եթե հատուկ նշված չէ: Մի խոսքով, յուրաքանչյուր գենի և բջջի յուրաքանչյուր շտրիխի համար (ֆիլտրացված է Cell Ranger- ի կողմից), մոլեկուլի յուրահատուկ նույնացուցիչները հաշվեցին թվային արտահայտման մատրիցներ կառուցելու համար: Երկրորդային ֆիլտրացիա Seurat վերլուծության համար. երեքից ավելի բջիջներում արտահայտված գենը համարվում էր արտահայտված, և յուրաքանչյուր բջիջ պետք է ունենա առնվազն 200 արտահայտված գեն:

RNA- հաջորդական վերլուծություն

Բոլոր մկների ՌՆԹ-ները վերլուծվել են Agilent Bioanalyser-ի միջոցով (Agilent, Santa Clara, CA, USA): ՌՆԹ-ի ամբողջականության թիվը տատանվում էր 3,4-ից մինչև 9,3, միջինը՝ 8,2: cDNA գրադարանները պատրաստվել են 18, 24.2, 68 և 100 նգ ընդհանուր RNA սկզբնական նյութերի տիրույթից ՝ օգտագործելով Ovation Universal RNA-seq համակարգը: cDNA գրադարանների երկարության բաշխումը մշտադիտարկվել է Agilent Bioanalyser-ի վրա ԴՆԹ բարձր զգայունության ռեագենտների հավաքածուի միջոցով: Բոլոր 11 նմուշները ենթարկվել են ինդեքսավորված զույգ ավարտի հաջորդականության `2 × 100 bp, Illumina Novaseq 6000 համակարգով (Illumina, San Diego, CA, USA):

Readsուգտկված վերջնական ընթերցումները կարճվել են trim_galore1- ով (տարբերակ. -Q 20 -լարվածություն 5 -զույգ): Կտրված զույգ ծայրով ընթերցումները քարտեզագրվել են մկնիկի GRCm38/mm10 հղման գենոմի հետ՝ օգտագործելով STAR2 (տարբերակ 2.6.0a) հավասարեցման գործիքը բազմապատիկ երկու անցուղի քարտեզագրմամբ: Քարտեզագրված ընթերցումները ամփոփվել են գենի մակարդակին՝ օգտագործելով featureCounts3-ը subread4 ծրագրային փաթեթում (տարբերակ 1.4.6-p5) և GENCODE թողարկման M19-ի գենային անոտացիայով: DESeq25-ն օգտագործվել է դիֆերենցիալ արտահայտված գեների վերլուծության համար, և նշանակալի գեները նույնացվել են Բենջամինի-Հոչբերգի ճշգրտված p-արժեքներով<0.05: DESeq2 վերլուծությունն իրականացվել է R 3.5.2 տարբերակում:

Ֆունկցիոնալ վերլուծության համար հիերարխիկ կլաստերացումը `հիմնված Էվկլիդեսյան հեռավորության և ամբողջական կապի վրա, կատարվել է R 'pheatmap' փաթեթի միջոցով: PCA- ն իրականացվել է R ‘prcomp’ փաթեթի միջոցով: Առաջին երկու հիմնական բաղադրիչները վերլուծվել են բազմաչափ ցրվածության վրա, որը ստեղծվել է R «scatterplot 3D» ֆունկցիայի միջոցով:

Էպիդերմիսի թերթերի պատրաստում և ներկում

DC-SIGN-DTR neg և DC-SIGN-DTR + մկները 2 օր բուժվել են DT- ով: Ականջները հավաքվել և բաժանվել են մեջքային և փորային կիսաերիզների և այնուհետև ինկուբացվել են 3.8% ամոնիումի թիոցիանատով (Sigma-Aldrich) PBS-ում 20 րոպե 37°C ջերմաստիճանում: Էպիդերմալ և մաշկային սավաններն առանձնացվել և ամրացվել են սառցե ացետոնի մեջ 15 րոպե: Այնուհետև, էպիդերմալ թիթեղները նախապես ինկուբացվել են 10 մգ/մլ հակա- Fc ընկալիչային հակամարմինով (2.4G2) սառույցի վրա 20 րոպե և այնուհետև ներկվել FITC պիտակավորված հակա-MHC II կարգի հակամարմինով ևս 30 րոպե սառույցի վրա ՝ LC- ի համար: վիզուալիզացիա:

Քանակական իրական ժամանակում PCR

Ականջները հավաքվել և անմիջապես համասեռացվել են TRIzol ռեակտիվում (Thermo Fisher Scientific): Ընդհանուր ՌՆԹ -ն հետագայում մաքրվեց `օգտագործելով RNAsimple Total RNA հավաքածուն (Tiangen Biotech Ltd, Պեկին, Չինաստան): Իրական ժամանակում ՊՇՌ-ն իրականացվել է արտադրողի ցուցումներին համապատասխան ՝ օգտագործելով Primer design Precision FAST արձանագրությունը (Primerdesign Ltd, Cambridge, UK):

LC-ների in vitro հասունացում

F4/80 hi CD326 + LC- ները մեկուսացվել են համակցված մկների էպիդերմիսի թերթերից և մաքրվել բջիջների տեսակավորմամբ (մաքրություն և gt90%): 5 × 10 4 LC- ներ անմիջապես օգտագործվել են RNA- ի մշակման համար, մնացած 5 × 10 4 LC- ները մշակվել են 96 հորատանցքով կլոր հատակի ափսեի մեջ 16 ժամ 20 նգ/մլ GM-CSF և 2 ժ/մլ LPS ներկայությամբ և մշակվել հաջորդ օրը ՝ ՌՆԹ մեկուսացման համար:

CHS- ի ինդուկցիա

WT և DC-SIGN DTR մկներին ներարկվել է DT և 2 օր անց զգայունացվել է ացետոնի և ձիթապտղի յուղի խառնուրդում լուծարված 1% DNFB-ով (4:1, v/v): DT ներարկումը կրկնվում էր 7 օր յուրաքանչյուր 3-4 օրը մեկ՝ LC լողավազանն անջատված պահելու համար: Երկու WT և DC-SIGN DTR մկների ականջները վիճարկվել են 0.5% DNFB- ով: Ականջի այտուցը չափվում էր ամեն օր՝ փորձարկումից հետո 12 օր անընդմեջ: Մկների մեկ այլ խումբ զոհաբերվել է փորձարկումից հետո 3-րդ օրը qPCR վերլուծության և մաշկի T-բջիջների արձագանքման վերլուծության համար:

CHS-ի նկատմամբ հանդուրժողականության ինդուկցիա

WT, CD207-DTR, Clec9A-DTR և DC-SIGN DTR մկներին յուրաքանչյուր 3-4 օրվա ընթացքում 20 օրվա ընթացքում ներարկում էին DT ՝ նպատակային բջիջների սպառումը պահպանելու համար (CD207-DTR: LC, cDC1 և LC բջիջների նման Clec9A-DTR: cDC1 և DC-SIGN-DTR: LC և CD11b բարձր բջիջներ): Մկների բոլոր շտամները հանդուրժվում էին 100 մկլ ծավալով 1% DNTB (Sigma-Aldrich) ՝ ացետոնի և ձիթապտղի յուղի խառնուրդում (AOO) (4: 1, v/v), էպիկուտանաբար ներարկվում էին սափրված որովայնին: WT մկների մի խումբ ներկվել է միայն AOO-ով որպես հսկիչ: 7 օր հետո մկների բոլոր շտամները զգայունացվեցին ՝ ականջների մեջքային հատվածը ներկելով մաշկի վրա 0.5% DNFB (Sigma-Aldrich) (25 μl AOO- ում) ներկով: Մկների մեկ այլ խումբ 5 օր անց ենթարկվեց ականջի վիճարկմանը `0,1% DNFB (4 μl AOO- ում), և ականջի այտուցը չափվեց թվային տրամաչափի միջոցով (Միտուտոյո, Կանագավա, Japanապոնիա) 6 օրվա ընթացքում: Մկների երկրորդ խմբում, ջրահեռացման LN- երը հավաքվել են հանդուրժումից/զգայունացումից հետո 5 -րդ օրը:

T- բջիջների արձագանքների վերլուծություն

CD8 + T- բջիջների IFN-γ արտազատելու ունակությունը որոշելու համար մեկուսացված բջիջները խթանվել են 96 հորանի կլոր հատակով (Corning, Corning, NY, ԱՄՆ) 10 նգ/մլ ֆորբոլ 12,13-երկբյուրատով (PMA, Sigma-Aldrich) և 1 մգ/մլ Ionomycin (Sigma-Aldrich) ամբողջական IMDM- ում 3 ժամ, որին հաջորդում է լրացուցիչ 2 ժամ ինկուբացիա 10 μg/ml Brefeldin A (Sigma-Aldrich) 37 ° C ջերմաստիճանում: Այնուհետև բջիջները հավաքվել և ներկվել են CD3 և CD8-ի համար, ամրացվել են 2% պարաֆորմալդեհիդով և թափանցել 0,05% սապոնինում (Sigma-Aldrich)՝ նախքան հակա-IFN-γ հակամարմիններով ներկելը: Ակտիվացված Տ -ն քանակականացնելու համարregs, մեկուսացված բջիջները համակողմանի ներկվել են CD4- ի և ICOS- ի համար, ամրացվել և թափանցվել `օգտագործելով Fix/Perm Buffer Set (eBioscience) ՝ նախքան Foxp3 հակամարմինով ներկելը:

Վիճակագրություն

Տվյալները ներկայացնում են միջինը ± SEM կամ SD, ինչպես նշված է նկարների լեգենդներում: GraphPad Prism ծրագրակազմն օգտագործվել է տվյալների ցուցադրման և վիճակագրական վերլուծության համար: Վիճակագրական թեստերն ընտրվել են տվյալների բաշխման և շեղման բնութագրերի համապատասխան ենթադրությունների հիման վրա: Բոլոր վիճակագրական թեստերը լիովին մանրամասն նկարագրված են նկարների լեգենդներում: Նմուշները վերլուծվել են երկկողմանի ուսանողների կողմից տ- երկու խմբերի միջև վիճակագրական տարբերությունները որոշելու համար: Երկուսից ավելի խմբերի միջև տարբերությունները որոշելու համար օգտագործվել է երկկողմանի ANOVA Բոնֆերոնի հետթեստով: P-արժեքը < 0.05 համարվել է վիճակագրորեն նշանակալի: Մեկ խմբում օգտագործված կենդանիների թիվը նշված է առասպելներում `որպես«n’.


Որքա՞ն արագ են տարբեր օրգաններ շրջում բջիջները: - Կենսաբանություն

C2006/F2402 '05 Դասախոսության ուրվագիծ 22 գ) 2005 թ. Դեբորա Մովշովից

Վերջին թարմացումը՝ 20.04.2005 10:19:

Ձեռնարկներ. 22A (Սրտի գործողության ներուժ) 22B (Սրտի կառուցվածք և ուժեղ շրջանառություն) 22C (որպես փոխանակում `հաջորդ անգամ լուսաբանվելու համար) 22D - Հարթ մկանային կառուցվածք: Հաղորդագրությունները համացանցում չեն ՝ 700 ցեխից դուրս արկղերում:

Որոշ գեղեցիկ վեբ հղումներ սրտի վրա

Լրացուցիչ ընթերցում.

Բժշկական տեղեկանք.

  • Ամերիկյան սրտի ասոցիացիա. Բազմակողմանի լավ կայք ՝ սրտի հիվանդության և սրտի առողջության վերաբերյալ տեղեկատվության համար:
  • Սրտակոթող. Սրտի հիվանդությունների մասին տեղեկատվության հիանալի հավաքածու, ինչպես նաև խորհուրդներ սրտի համար առողջ ապրելակերպի վերաբերյալ:

A. Ինչի՞ց է օգտագործվում հարթ մկանները: Ի՞նչ եզակի հատկություններ ունի այն:

1. Գտնվելու վայրը - դրա մեծ մասը կազմում են սնամեջ օրգանների և ուժեղացուցիչների պատերը: Պահպանում է ձևը և առաջ է մղում բովանդակությունը:

2. Կծկման արագություն և հոգնածության արագություն - համեմատաբար դանդաղ:

3. Հնարավոր է ամրացման վիճակ - կարող է երկարաժամկետ պայմանագրով մնալ առանց ATP- ի ներդրման: (Մեկ ATP բաժանում մեկ կամրջի ցիկլի համար, բայց ցիկլը շատ ավելի դանդաղ է:)

4. Երկարություն, որի վրա այն կծկվում/ձգվում է ես - համեմատաբար երկար:

5. Պայմանավորվում/թուլանում է ի պատասխան բազմաթիվ տարբեր գրգռիչների - նյարդեր, հորմոններ, ձգում և այլն:

Ընդհանուր առմամբ. կարող է ինտեգրել բազմաթիվ ազդանշաններ և պահպանել "տոնտոն" երկարության լայն շրջանակում՝ ATP-ի խնայողաբար օգտագործմամբ:

B. Ca ++ - ն առաջացնում է կծկում

1. Ca ++ - ի դերը . Հաստ թելերի վիճակը, ոչ թե բարակ վիճակը, ազդում են Ca ++ - ի վրա:

2. Որտեղից է գալիս Ca ++-ը
:

ա. Ca ++ - ի մեծ մասը գալիս է բջիջից դուրս: Նեյրոհաղորդիչները, հորմոնները և այլն բացում են Ca ++ ալիքները պլազմային թաղանթում՝ օգտագործելով երկրորդ սուրհանդակները, իսկ Ca ++-ը գալիս է արտաբջջային հեղուկից (ECF): Որոշ հարթ մկանների մեջ Ca ++ ալիքների լարվածությունը բացվում և առաջացնում է AP:

բ. Մի փոքր Ca ++ թողարկվում է ER- ի կողմից: (Տես "Ca ++ հրահրված Ca արտազատումը" նկարագրված ստորև):

1. Հարթ մկանները չեն պարունակում տրոպոնին (ունի տրոպոմիոզին, բայց չի արգելափակում ակտին-միոզին կապող տեղերը)

2. Ակտինի/միոզինի փաթեթների կազմակերպում - տես թերթիկ 22D, ներքևում:

3. Միջանկյալ թելեր - միացրեք խիտ մարմինները և ուժեղացուցիչը օգնեք փաթեթները տեղում պահել: (Խիտ մարմին = կմախքի մկանների Z գծի նույն գործառույթը):

4. Չկան T խողովակներ:

5. Երկու տեսակ:

ա. Single Unit հարթ մկաններ - բջիջները միացված են բացերի միացումներով և կծկվում են որպես միավոր:

բ. Բազմաբնակարան հարթ մկան - բջիջները միացված չեն էլեկտրականորեն բջիջները խթանվում և կծկվում են առանձին:

Դ.Կալմոդուլինը վերահսկում է կծկման/Ca ++ արձագանքը (տրոպոնինի փոխարեն): Տես Բեկեր թզ. 23-24 & amp Ամսագիր 22D, միջին:

1. Calmodulin-Ca ++ բարդ ձևեր

2. Կալմոդուլին-Ca ++ համալիրը կապում և ակտիվացնում է կինազը (MLCK)

3. Կինազը ֆոսֆորիլացնում եւ ակտիվացնում է միոզինը (այնպես որ այն կարող է կապել ակտին)

D. Ակտինի հասանելիություն կարող է կարգավորվել այլ գործոններով, բայց ոչ Ca ++

E. Խաչ կամրջի ցիկլ - Կարող է երկար ժամանակ կայուն խաչմերուկներ պահել առանց ATP- ի խախտման (կամրջի դանդաղ ցիկլի պատճառով `դանդաղ ATPase և ավելի դանդաղ Ca ++ պոմպ: Դեռևս պետք է մեկ խաչմերուկի համար օգտագործված մեկ ATP- ի պատրաստում/խափանում):

F. Արագություն - կծկումն ավելի դանդաղ է, քան կմախքի դեպքում, քանի որ.

1. Բաղադրիչը պահանջում է ֆոսֆորիլացում նախքան կամրջի ցիկլը սկսելը

2. ATPase myosin դանդաղ ստանալ ավելի դանդաղ կծկում (կամրջի դանդաղ ցիկլ), բայց ավելի քիչ հոգնածություն

G. Կծկման ձգան - նյարդայնացման և ուժեղ հորմոններ

1. Ինքնավար համակարգ և (կամ) հորմոններ , ոչ սոմատիկ (ինչ վերաբերում է ոսկրային):

ա. Խթանումը կարող է լինել գրգռիչ կամ արգելակող:

(1): Հորմոնները և հետգանգլիոնային նեյրոնների վեգետատիվ նեյրոհաղորդիչները անուղղակիորեն ազդում են ալիքների և ուժեղացնող պոմպերի վրա՝ օգտագործելով 2-րդ սուրհանդակները: (Համեմատեք նյարդերի/մկանների սինապսի իրավիճակի հետ):

(2). Օրինակներ նախորդ դասախոսությունների ժամանակ. էպինեֆրինը կարող է առաջացնել հարթ մկանների կծկում (IP3-ի միջոցով) կամ թուլացում (cAMP-ի և Ca ++ պոմպի միջոցով): Արձագանքը կախված է հարթ մկանների ընկալիչներից:

բ. Խթանումը կարող է առաջացնել գործողությունների ներուժ (բացել Ca ++ ալիքներ) կամ գործել երկրորդ սուրհանդակի միջոցով `ազդելով Ca ++ մակարդակի վրա (առանց ԱԵԱ անցնելու): Տես վերը նշված օրինակները:

գ. Արտաքին խթանիչը կարող է անհրաժեշտ չլինել: Որոշ հարթ մկաններ ունեն խթանիչ բջիջներ, որոնք ինքնաբերաբար առաջացնում են AP: Ինքնավար և/կամ հորմոնալ խթանումը մոդուլացնում է սրտի ռիթմավարների ներքին ազդանշանների ազդեցությունը:

2. Նյարդի/մկանների սինապսի կառուցվածքը տարբեր է - նեյրոններն ունեն բազմաթիվ վարիկոզիտներ (հարթ մկանների հետ շփման կետեր - պարունակում են նեյրոհաղորդիչի վեզիկուլներ), և մկանները չունեն բարդ կառուցվածք սինապսում (առանց շարժիչի վերջավոր թիթեղների): Մեկ վեգետատիվ նեյրոնը կարող է խթանել հարթ մկանների բազմաթիվ բջիջներ և մեկ/մեկ մկանային բջիջի բազմաթիվ միավորներ: Տես ձեռնարկ 22D, վերևում: Մեկ հարթ մկանային բջիջ (կամ մեկ միավոր հարթ մկան) կարող է մուտքագրվել ինչպես PS-ից, այնպես էլ S-ից:

Փորձեք 9-1 խնդիրը, մասեր C & amp D, և փորձեք պատասխանել 9-4 հարցին հարթ մկանների դեպքում: Եթե ​​մենք ավարտենք հարթ մկանները, դուք պետք է կարողանաք կատարել 9-րդ հավաքածուի բոլոր խնդիրները:

1. Կամուրջի ցիկլ և այլն: շատ նման է կմախքի . Ca ++ դերի մանրամասների համար տե՛ս ստորև:

2. Նման է օքսիդացնող/դանդաղ ձգվող կմախքի - հոգնածության ցածր մակարդակ, բայց շատ թթվածնից կախված:

3. Բջիջները միացված են էլեկտրականությամբ (միջքաղաքային սկավառակների բացերի հանգույցներ)

4. Թաղանթում AP- ի հատուկ առանձնահատկությունները (տես թերթիկ 22-Ա)

ա. AP- ն տևում է շատ ավելի երկար (այնքան ժամանակ, որքան կծկումը), ուստի տետանիան անհնար է: Յուրաքանչյուր կծկում ավարտվում է մինչև հաջորդ AP-ի ժամանումը: (տե՛ս նկ. 14-15 մատյանում և AMP 47.7 & 49.8 (47.11) Purves)

բ. Երկարաձգված AP- ն (երկար բևեռացված փուլ) պայմանավորված է դանդաղ լարման դարպասով K+ դարպասների բացման և Ca ++ ալիքների բացման հետաձգման պատճառով: (տե՛ս նկ. 14-14-ը թերթիկի վրա և ուժեղացուցիչ 49.8-ը Purves- ում):

5. Սրտախթանիչների դերը: Կծկման ազդակը ազդանշան է սրտի խթանիչ բջիջներից, այլ ոչ թե նյարդի AP- ից: (Ինքնավար նեյրոնները արձակում են հաղորդիչներ, որոնք դանդաղեցնում կամ արագացնում են կծկումները, տես ստորև):

B. Արագացուցիչի խթանիչ բջիջներ -հայտնաբերվել է սրտի և որոշ հարթ մկանների մեջ-տե՛ս 22-A (նկ. 14-16) թերթիկը կամ Purves 49.6 (49.7):

1. Սահմանեք սրտի բաբախման արագությունը

2. Կրակ տարերայնորեն

3. Դանդաղ ապամոնտաժեք մինչև շեմ -& gt pacemaker ներուժ --- & gt AP երբ հասնի շեմին:

Սրտի դանդաղ բևեռացման ընդհանուր պատճառը. Ավելի շատ Na + և Ca ++ արտահոսում են, և ավելի քիչ K + արտահոսում է ՝ աստիճանաբար դեպոլարիզացնելով բջիջը: Իոնների շարժումը վերահսկվում է բազմաթիվ ալիքներով. Տե՛ս թերթիկները և ստորև:

4. Ներառված ալիքներ. Իոնային հոսքերը և խթանիչների ներուժը առաջացնող ալիքները բավականին բարդ են: Ահա որոշ կարևոր կետեր, տեսեք առաջադեմ տեքստեր, եթե ձեզ ավելի շատ մանրամասներ են հետաքրքրում:

ա. Եսզ ալիքներ. Na + անցնում է Na + /K + ալիքով, որը նման է մեկ --- & gt EPSP- ին: Այս ալիքը = Iզ ալիք 22Ա թերթիկի վրա: Na +- ն դանդաղ է ներթափանցում ՝ բջիջը դեպոլարիզացնելով մինչև շեմ: The Iզ ալիքները կոչվում են «զվարճալի» ալիքներ, քանի որ դրանք բացվում են, երբ բջիջը հիպերպոլարիզացված է, այլ ոչ թե երբ այն բևեռացված է:

բ. K + արտահոսքի ալիքներ. Արագացուցիչի ներուժի ընթացքում դանդաղ բևեռացումն առաջանում է բջիջից K + արտահոսքի ալիքների փակմամբ, ի լրումն I- ի բացման:զ ալիքներ, որոնք թույլ են տալիս Na + ներթափանցել: Քանի որ K + հոսքը (արտահոսքի ալիքներով) նվազում է, Na + աննշան արտահոսքը (I- ի միջով)զ կապուղիներ) ապաբեւեռացնում է բջիջը: Եթե ​​K + արտահոսքի ալիքները բաց մնան, նրանք կարող են հակակշռել Na + արտահոսքի հետևանքները: Հաղորդիչները և (կամ) հորմոնները կարող են փոխել արտահոսքի ալիքների և ուժեղացուցիչի կամ I- ի վիճակըզ ալիքները, ինչպես բացատրվում է ստորև:

գ. Ca ++ ալիքները նույնպես ներգրավված են կարդիոսթափողի ներուժի ուշ փուլերում:

5. դերը Ինքնավար innervation. S/PS թողարկման հաղորդիչներ -& gt բացել/փակել K + արտահոսքի ալիքները, Ca ++ ալիքները և/կամ Iզ ալիքներ-& gt ավելի արագ կամ դանդաղ ապաբեւեռացում = ավելի կտրուկ կամ ավելի հարթ սրտի խթանիչ պոտենցիալ --- & gt սրտի խթանիչ բջիջները վաղ թե ուշ կրակում են AP- ով-& gt ավելի արագ կամ նվազում են սրտի բաբախյունը: (տես Պուրվս 49.6 (49.7))

Նշում. Հաղորդիչները կարող են ազդել նաև AP- ի արձակման համար անհրաժեշտ շեմի արժեքի և/կամ խթանիչ խցերի առավելագույն հիպերպոլարիզացիայի վրա. Դա կարող է նաև ազդել AP- ների միջև ընկած ժամանակի վրա: (Եթե հետաքրքրված եք, դիտեք առաջադեմ տեքստերը):

6. Սրտի խթանիչ բջիջներում AP- ն (ներուժի աճ) մեծապես պայմանավորված է Ca ++ - ի ներխուժմամբ ոչ Na + . (տե՛ս նկ. 14-6, վահանակ (գ) 22A թերթիկում): Երբ բջիջները դեպոլարիզացվում են մինչև շեմ, բացվում են Ca ++ կապուղիներով լարման, ոչ թե Na + ալիքների լարման:

Տես խնդիրները 11-1 & amp 11-2:

C. Գրգռում-կծկում զուգավորում - ինչպես է մկանային պլազմայի մեմբրանում AP- ն հանգեցնում մկանի ներսում խաչաձև կամրջի գործունեության:

1. Ինչ է տեղի ունենում ինչպես սրտի, այնպես էլ կմախքի մկանների մեջ.

ա. Մկանային թաղանթում AP-ն անցնում է T խողովակների մեջ:

բ. Սպիտակուցները T խողովակի թաղանթում ակտիվանում են (փոխում են կոնֆորմացիան) ի պատասխան լարման տարբերությունների:

գ. T tubule- ի ակտիվացված ընկալիչները խթանում են ER/SR- ում Ca ++ ալիքների բացումը: (Ինչպես DHP ընկալիչները բացում են ուղիները ER- ում, տարբերվում է մկանների երկու տեսակների միջև. Կապը մեխանիկական է կմախքի մկանների մեջ `սրտամկանի Ca ++ արտազատման միջոցով: Տես ստորև):

դ. Ca ++-ն ազատվել է ER/SR-ից:

ե. Cիտոպլազմիկ Ca ++ - ի ավելացումը խթանում է խաչաձև կամրջի սկիզբը:

զ. Կծկումն ավարտվում է, երբ Ca ++ - ը հեռացվում է: (Ca ++-ը հետ է ուղարկվում այնտեղից, որտեղից այն եկել է. հետ մղվում է ER կամ բջջից դուրս՝ օգտագործելով ATP):

2. Ինչո՞վ է տարբերվում սրտի մկանները

ա. Մեմբրանում լարման ակտիվացված սպիտակուցները Ca ++ ալիքներն են:

բ. AP-ն առաջացնում է Ca ++ կապուղիների բացում T խողովակում Փոքր քանակությամբ Ca ++ արտաբջջային հեղուկից (ECF) T խողովակում մտնում է ցիտոպլազմա:

գ. «Ca ++ հրահրված Ca արտազատում». ECF-ից Ca ++-ի փոքր քանակությունը կապվում է ER-ի մակերևույթի ընկալիչների հետ և բացում է Ca ++ ալիքները ER/SR-ում. (Տարբերվում է նաև հարթ մկանների մեջ, բայց ER-ից Ca ++ արտազատման քանակությունը այնքան էլ նշանակալի չէ):

Տեղեկատվություն տեղեկատվական դաշտում. Վերը նշված պլազմային մեմբրանի լարման ակտիվացված սպիտակուցները սովորաբար կոչվում են DHP կամ դիհիրոպիրիդին ընկալիչներ: Հարթ և սրտի մկանների մեջ DHP ընկալիչները նույնպես Ca ++ ալիքներ են: ER- ում Ca ++ ալիքները կոչվում են ռյանոդինի ընկալիչներ: (Անունները գալիս են համապատասխան սպիտակուցներին կապող արգելակիչներից): DHP և ռյանոդին ընկալիչները միացված են մկանների բոլոր երեք տեսակների մեջ, սակայն միացման մեխանիզմը տարբեր է:

3. Ինչո՞վ է տարբերվում հարթ մկանները: Ոչ մի T tubules Ca ++ հիմնականում գալիս է բջիջից դուրս: Փոքր քանակությամբ "Ca ++-ն առաջացրել է Ca արտազատում" ER-ից նույն մեխանիզմով, ինչ սրտի մկանների դեպքում:

III. Սրտի կառուցվածքը և ուժեղացուցիչի գործառույթը (տես թերթիկ 22B): Որտե՞ղ են կծկող և խթանիչ բջիջները:

A. Սրտի կառուցվածքը -- Purves Նկար 49.3 (49.4) -- նկատի ունեցեք, որ բոլոր նկարները ցույց են տալիս անձը դեմքով ձեր դեմքով, այնպես որ " աջ" Սրտի 1/2-ը նկարի ձախ կողմում է: Վերևի և ներքևի մետրոյի գծապատկերները ցույց են տալիս, թե ինչն է ինչի հետ կապված և ինչպես է ընթանում արյան ընդհանուր հոսքը, բայց ոչ իրական անատոմիա: Միջին նկարները ցույց են տալիս իրական կառույցների մոտարկումներ:

B. Դիրքը, սրտի ռիթմի խցերի (հանգույցների) գործառույթը, His, Purkinje մանրաթելերի փաթեթը - տես Purves նկ. 49.7 (49.8) & ուժեղացուցիչ միջին աջ

1. Այս բոլոր բջիջներն ունեն սրտի ռիթմավարի ակտիվություն -- կազմում են հաղորդման համակարգը -- AP-ը տեղափոխում են սրտի բոլոր մասերը:

2. SA հանգույց սովորաբար պատասխանատու: SA հանգույցն ունի կրակելու ամենաարագ ռիթմը `սովորաբար վերահսկում է սրտի բաբախյունը: Առաջին հերթին հրդեհներ:

3. AP- ի դերը SA հանգույցում: Առաջացնում է նախասրտերի կծկում ՝ արյունը մղելով փորոքների մեջ: Կարճ ուշացումից առաջացնում է AV հանգույցի բռնկում

4. AP- ի հանգույցում AP- ն տարածվում է His և Purkinje մանրաթելերի փաթեթին

5. Նրա կապոցը և այլն առաջացնում են փորոքների սեղմում , ներքևից վեր՝ արյունը սրտի վերևից դուրս մղելով:

Տե՛ս Խնդիրներ 11–3, 11–4 և ուժեղացուցիչ 11–6:

Գ. Շրջանառության ընդհանուր պատկերացում - տես թերթիկ 22B և Purves p. 945 (870)։

1. Շրջանառության 2 օղակ կա - դեպի թոքեր (թոքային) և մարմնին (համակարգային)- տե՛ս նկարը ներքևում: Տարբեր արյան անոթներ զուգահեռաբար անցնում են մարմնի տարբեր մասերին: (Օգնում է համեմատել 22B- ի բոլոր նկարները `հասկանալու սրտի կառուցվածքը և շրջանառությունը):

2. eriesարկերակները հեռանում են սրտից պարտադիր չէ, որ հագեն թթվածնով արյուն

3. Կառուցվածքը: Զարկերակները և երակները, զարկերակները և երակները շրջապատված են հարթ մկանային մազանոթներով:

4. Սրտի ցիկլ - սիստոլ և ամաստի դիաստոլ

ա. Systole - ventricles contract (& quotsqueeze & quot), արյունը մղվում է դեպի համակարգ

բ. Diastole - փորոքները հանգստանում են, լցվում են արյունով

գ. Նշում. Սիստոլա (կծկում) և դիաստոլա (թուլացում) տերմինները կարող են օգտագործվել փորոքների վիճակի կամ նախասրտերի վիճակի վերաբերյալ: Սովորական օգտագործման դեպքում տերմինները միշտ վերաբերում են փորոքների վիճակին:

Տես խնդիրը 11-5:

IV. Գազի փոխանակում - ինչպես եք ստանում O2 դեպի բջիջներ և CO2 դեպի թոքեր? Տեսեք Գազի փոխանակման ձեռնարկներ (22C և AMP) և AMP Purves 48.14 (48.17):

A. Փոխանակում (թթվածնի, ածխածնի երկօքսիդի և այլ սննդանյութերի և թափոնների) մազանոթներում: (Կառուցվածքների համար տե՛ս Purves նկ. 48-10 (48-12) կամ թերթիկ 22D:

1. Թոքերի մեջ. ալվեոլի նյութերը փոխանակվում են թոքային մազանոթների նյութերի հետ

2. Հյուսվածքներում. բջիջներում նյութերը փոխանակվում են համակարգային մազանոթների նյութերի հետ

3. Կառուցվածքը: մազանոթներն ունեն մեծ մակերես և արյան դանդաղ հոսք ՝ նպաստելով փոխանակմանը

Մնացած նյութը կներկայացվի հաջորդ անգամ:

1. Հեմոգլոբինը (Hb) կապում է & amp; թակարդները O2 կարմիր արյան բջիջներում (RBC) թոքերում (տես թերթիկ 22C, վահանակ B)

2. Hb- ն թողարկում է O- ն2 հյուսվածքներում (տես թերթիկ 22C, վահանակ D)

3. Hb- ն ունի շատ կարևոր հատկություններ, որոնք հնարավորություն են տալիս այն ճիշտ գործել, եթե ժամանակը որոշ անգամ քննարկվի հաջորդ անգամ:

C. Ինչպե՞ս է CO2- ը տեղափոխվում: Տես թերթիկ 22C վահանակներ A & amp C կամ Purves նկ. 48.14 (48.17)

1. Ի՞նչ է տեղի ունենում հյուսվածքներում: (Վահանակ C 22-C-ում)

ա. CO2 նյութափոխանակությունից մտնում է ՌԲԿ

բ. ՌԲԿ -ի ներսում կարբոնիկ անհիդրազը (հայտնի ամենաարագ ֆերմենտներից մեկը ՝ 6 X 10 5 /վրկ # - ի փոխակերպումը) փոխակերպում է CO2 դեպի կարբոնաթթու: Թակարդներ CO2.

գ. Կարբոնաթթուն բաժանվում է երկածխաթթվային և H +: (Սա իրականում առանձին քայլ չէ. ֆերմենտը ուղղակիորեն առաջացնում է երկածխաջրեր):

դ. Անիոնափոխանակիչը (տիրույթ 3 սպիտակուց) փոխարկում է երկածխաջրերը (բջջում) արյան մեջ Cl-ի համար:

ե. Որոշ CO2 և H +-ը կապվում է Hb-ին (դեօքսիգենացված)

2. Ի՞նչ է տեղի ունենում թոքերում: (22-C վահանակ A)

ա. Վերևում նկարագրված գործընթացը հակադարձում է. նորից մտնում է բջիջ, վերածվում CO-ի2և այլն։

բ. CO2 թողարկվել է օդ (ցածր CO2 ալվելոլի/օդի քաշման CO- ում2 Լե Շատելիեի բարձրագույն CO սկզբունքով2 կոնց. արյան մեջ, քան ալվեոլներում)

գ. Օ2 օգնում է հեռացնել CO- ն2 և H + Hb- ից: (Լրացուցիչ հրում գործոն):

Հաջորդ անգամ. Գազի փոխանակում, շարունակություն Ինչպե՞ս է պահպանվում աղի և ուժեղացուցիչի հավասարակշռությունը:


Կենդանիների թուխ. Բոլոր կենդանի իրերը արտազատում են թափոններ:

Սնունդը մի ծայրում, իսկ մյուս ծայրից դուրս թափեք: Դա և բացատրում է, թե ինչպես է այն աշխատում: Երբևէ մտածե՞լ եք, թե ինչ է պատահում կենդանիների կողմից կատարվող բոլոր թզուկներին: Դա լավ հարց է կենսաբանի համար:

  • Արձագանքել գրգռիչների նկատմամբ: Եթե ​​դուք քար եք տալիս, այն կարող է պատասխանել: Ickղոտի՛ր ինձ, և ես գոռամ: Ավելի լուրջ, սակայն, շրջակա միջավայրի գրգռիչներին արձագանքելու կարողությունը, լինի դա կապիկների խումբը, որը գնում է դեպի ծառերը, երբ նրանցից մեկը ահազանգ է հնչեցնում, թե տերևը շրջվում է դեպի արևը, կենդանի էակների հատկանիշն է:

Երախտագիտություն

Շնորհակալություն ենք հայտնում Iden լաբորատորիայի բոլոր անդամներին քննարկումները խթանելու համար, իսկ Սինա Կնապին ՝ վերանայման նախագծի քննադատական ​​ընթերցման համար: Այս աշխատանքին աջակցել են Սաարլենդի համալսարանը, Deutsche Forschungsgemeinschaft (DFG, Գերմանական հետազոտական ​​հիմնադրամ, դրամաշնորհներ SPP1782-ID79/2-1 և SPP1782-ID79/2-2 և Projektnummer 73111208-SFB 829, A10), գերմանական դաշնային Գերազանցության նախաձեռնություն և նահանգների կառավարությունները (CECAD Քյոլն) և Մոլեկուլային բժշկության կենտրոն Քյոլնը (CMMC): Բաց մուտքի ֆինանսավորումը միացված և կազմակերպված է ProjektDEAL- ի կողմից: